ID: 966606329

View in Genome Browser
Species Human (GRCh38)
Location 3:181825082-181825104
Sequence TTGCATCTGAATAAGGAACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966606329_966606336 -6 Left 966606329 3:181825082-181825104 CCTTGTTCCTTATTCAGATGCAA No data
Right 966606336 3:181825099-181825121 ATGCAAAAGGGGGAGGACAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966606329 Original CRISPR TTGCATCTGAATAAGGAACA AGG (reversed) Intergenic
No off target data available for this crispr