ID: 966616285

View in Genome Browser
Species Human (GRCh38)
Location 3:181916714-181916736
Sequence CAGAGTTAGGAGCAGGATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966616285_966616289 16 Left 966616285 3:181916714-181916736 CCTCCATCCTGCTCCTAACTCTG No data
Right 966616289 3:181916753-181916775 TCTCAGAGCAATAGAAGCTTTGG No data
966616285_966616290 17 Left 966616285 3:181916714-181916736 CCTCCATCCTGCTCCTAACTCTG No data
Right 966616290 3:181916754-181916776 CTCAGAGCAATAGAAGCTTTGGG No data
966616285_966616291 20 Left 966616285 3:181916714-181916736 CCTCCATCCTGCTCCTAACTCTG No data
Right 966616291 3:181916757-181916779 AGAGCAATAGAAGCTTTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966616285 Original CRISPR CAGAGTTAGGAGCAGGATGG AGG (reversed) Intergenic
No off target data available for this crispr