ID: 966619868

View in Genome Browser
Species Human (GRCh38)
Location 3:181952333-181952355
Sequence TCTGGTGCCCAGGAGCACCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 316
Summary {0: 1, 1: 0, 2: 3, 3: 31, 4: 281}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966619861_966619868 24 Left 966619861 3:181952286-181952308 CCATAGAATGCCCAGACAACTAA No data
Right 966619868 3:181952333-181952355 TCTGGTGCCCAGGAGCACCATGG 0: 1
1: 0
2: 3
3: 31
4: 281
966619862_966619868 14 Left 966619862 3:181952296-181952318 CCCAGACAACTAAACTGACATCT No data
Right 966619868 3:181952333-181952355 TCTGGTGCCCAGGAGCACCATGG 0: 1
1: 0
2: 3
3: 31
4: 281
966619863_966619868 13 Left 966619863 3:181952297-181952319 CCAGACAACTAAACTGACATCTT No data
Right 966619868 3:181952333-181952355 TCTGGTGCCCAGGAGCACCATGG 0: 1
1: 0
2: 3
3: 31
4: 281

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966619868 Original CRISPR TCTGGTGCCCAGGAGCACCA TGG Intergenic
900165429 1:1242548-1242570 TCACGTGCCCAGGAGCAGCCCGG + Exonic
900338665 1:2177392-2177414 TATGGGGCCCACCAGCACCATGG + Intronic
900710047 1:4107890-4107912 AGTGGTGCCAAGGAGCACCTTGG - Intergenic
900711364 1:4116632-4116654 CCAGGAGCCAAGGAGCACCAAGG - Intergenic
900830683 1:4963238-4963260 TATGGTCCCCAAGACCACCAGGG + Intergenic
901164454 1:7207916-7207938 TCTGCTGCCCAGCAAAACCAGGG + Intronic
901428971 1:9200907-9200929 TCCAGTGCCCAGGACCACCTGGG + Intergenic
901534650 1:9874292-9874314 TCTGGTGCCCAGGAGTACAGTGG + Intronic
902402243 1:16164632-16164654 ACTGGTGCCCAGGGGCCCCCAGG + Intergenic
905276044 1:36818944-36818966 GCTGGTGGCCAGCAGGACCAGGG + Intronic
906247215 1:44284781-44284803 TCTGAGGCACAAGAGCACCAGGG + Intronic
906322867 1:44827606-44827628 TGTGGTGCCTCGGGGCACCAAGG - Exonic
907519604 1:55014545-55014567 TCAGGTGCCCATGTGCACCTGGG + Intergenic
910689270 1:89949244-89949266 TCTGTTGCCCAGGAGTGCAATGG - Intergenic
911594884 1:99788346-99788368 TCTGTTGCCCAGGAGTACAGTGG - Intergenic
912997845 1:114549547-114549569 TCTGTTGCCCAGGAGTGCAATGG + Intergenic
915963121 1:160283556-160283578 TCTGGGGCCCCGAAGCATCAGGG + Exonic
916008417 1:160682379-160682401 GCTGGAGCCCAGGAGTTCCAGGG + Intronic
919474417 1:198017026-198017048 CCTGAGGACCAGGAGCACCAAGG + Intergenic
920243935 1:204573950-204573972 TCTGGTTCCCAGGTAAACCAGGG - Intergenic
920254077 1:204642503-204642525 TCCTGTGCCCAGGAGTAGCAGGG + Intronic
920382162 1:205541466-205541488 TCTGCAGCCCAGGAACACCTAGG - Intergenic
920503116 1:206497817-206497839 TCTAGTACCCAGGAACATCAAGG - Intergenic
921720266 1:218463505-218463527 TGTGGTGCCCAGAAGCATAAAGG - Intergenic
922576830 1:226666424-226666446 CCTGGTGTCCAGGGGCTCCAGGG + Intronic
924180242 1:241433773-241433795 TATGGTTCCCAAGAGCACCAAGG - Intergenic
1065051287 10:21794228-21794250 TCTGTTGCCCAGGAGTGCAATGG - Intronic
1067003217 10:42637165-42637187 TCTTGTGCCCAAGAGCTACATGG - Intronic
1067575973 10:47408945-47408967 TTTGGGGCCGAGGAGAACCAAGG - Intergenic
1071126234 10:82338472-82338494 TCTGCCTCCCAGGAGCAACAAGG - Intronic
1073183776 10:101602970-101602992 GCTGTTGGCCAGGAGCTCCATGG + Intronic
1075390190 10:122086103-122086125 TGGGATTCCCAGGAGCACCATGG + Exonic
1077283423 11:1755557-1755579 GCTCCTGCCCAGGAGCACCTTGG - Intronic
1077504500 11:2923831-2923853 TCTGGTTCCCAGCAGCAGCTTGG + Intronic
1078417641 11:11178802-11178824 TCTGGGGCAGAGGAACACCATGG + Intergenic
1078517178 11:12032450-12032472 TTTGGTGCCCAGGAACATGATGG - Intergenic
1078830315 11:14971884-14971906 TCTGGAGCCCAGCAGTCCCAGGG - Intronic
1080611353 11:33906713-33906735 GCTGGTGACCCGGAGCTCCACGG - Intergenic
1081156809 11:39703461-39703483 TCTGCTGCCTAGGAGTACAATGG + Intergenic
1081695861 11:45108658-45108680 TGTGGTGCCCAGAGGCACCAGGG + Intronic
1081998179 11:47377857-47377879 TTTGGTTTCCAGGAGCCCCAAGG + Intronic
1082097864 11:48145890-48145912 TCTGTTGCCCAGGAGTACAGTGG + Intronic
1084220356 11:67674160-67674182 CCTGTTCCCCAGGAGCCCCAGGG - Intronic
1084789393 11:71463786-71463808 GCTGGTGACCAGGCGCTCCAAGG - Intronic
1085084931 11:73660712-73660734 TCAGGTGCCCAGGAACTCCCTGG - Intronic
1088746850 11:112811171-112811193 TCTGTTGCCCAGGAGCATGAAGG - Intergenic
1088818959 11:113440860-113440882 TCTGTGTCCCAGGAGCCCCAAGG - Intronic
1088982336 11:114875034-114875056 TCTGGGGCCCAGAGGCTCCATGG - Intergenic
1090973774 11:131664962-131664984 TCTGGTGCCCAGCAGAAGCGCGG - Intronic
1091788656 12:3258370-3258392 TCTGGGGCCCAGAATCACCTTGG + Intronic
1092240296 12:6831880-6831902 GCTGGTCCCCAGGTGCTCCATGG - Exonic
1097179350 12:57162497-57162519 TATGATGCCCAGCAGCAGCAAGG + Exonic
1098384376 12:69903468-69903490 TCCGGGGCCCAGGAGAGCCAGGG - Intronic
1100800033 12:98221380-98221402 TCTGGTGCCAGGGAACAGCAAGG - Intergenic
1101592176 12:106134442-106134464 TCTAGTGGCCAGGGGCACCAGGG + Intronic
1101803702 12:108045061-108045083 TCTGGTGCCCCAGATCAGCATGG - Intergenic
1102590127 12:113950541-113950563 TCAGGTGCCCAGGAGCAGAGTGG - Intronic
1103940371 12:124498274-124498296 TCTGGTGCCCGTGTGCACCATGG - Intronic
1106100832 13:26694345-26694367 CCTGGTGCCCAGGGGCATCTCGG - Intergenic
1110940013 13:81338533-81338555 TCTGTTGCCCAGGAGTACAGTGG - Intergenic
1114584931 14:23802631-23802653 TCTGGAGCCCAGGAAGATCAAGG + Intergenic
1116992052 14:51286978-51287000 GCTGGTTCCCAGGAGCTGCAGGG - Intergenic
1117965694 14:61205055-61205077 TCTGGTCCCAAGGAGAACCCAGG - Intronic
1118674984 14:68174292-68174314 CCTGGAGCCCAGGAGTTCCAGGG + Intronic
1118723081 14:68608121-68608143 GCTGGTGCCCAGCTGCACCTGGG - Intronic
1119619382 14:76120239-76120261 TGTAGTGCCCAGGGGCACCTTGG + Intergenic
1121015327 14:90545583-90545605 TGTGGAGACCAGGAGGACCAGGG + Intronic
1121342482 14:93113980-93114002 ACGGGCCCCCAGGAGCACCAGGG + Intronic
1122352250 14:101103011-101103033 TCTGGTGCCCTGGAACCCCCTGG - Intergenic
1122397353 14:101442634-101442656 CCTGTGGCCCAGGCGCACCAAGG + Intergenic
1122454798 14:101841923-101841945 TCAGGTGCCAAGAAGCTCCATGG - Intronic
1122722994 14:103732471-103732493 GCTGGTGCTCAGGAGCACCCAGG - Intronic
1122823040 14:104356598-104356620 GCTGGGGCCCAGCAGCTCCAGGG + Intergenic
1124670645 15:31635281-31635303 TGTAGGTCCCAGGAGCACCAAGG - Intronic
1124842044 15:33251350-33251372 ACTTGTGCCCAGGAGGTCCAAGG - Intergenic
1127799413 15:62464957-62464979 TCTGTTGCCCATGGGCACTATGG + Intronic
1128285921 15:66436984-66437006 TGTGGATCCCAGGAGCAGCAGGG - Intronic
1129674679 15:77626108-77626130 ACTGAGGCCCAGGAGCATCAGGG + Intronic
1130467620 15:84200306-84200328 GCTGGGGCACAAGAGCACCAGGG - Intergenic
1130496645 15:84473236-84473258 GCTGGGGCACAAGAGCACCAGGG + Intergenic
1130589912 15:85204904-85204926 GCTGGGGCACAAGAGCACCAGGG - Intergenic
1131005592 15:88974964-88974986 TCTGTTGCCCAGGAGTGCAACGG - Intergenic
1131058112 15:89388267-89388289 GCTGGTTCCAAGGACCACCAAGG - Intergenic
1131375059 15:91916360-91916382 ACCGATGCCCAGGAGCACCTGGG - Exonic
1132685052 16:1158731-1158753 ACTCGTTCCCAAGAGCACCAAGG - Intronic
1133382935 16:5346137-5346159 TCCAGAGCCCAGGAGCTCCACGG - Intergenic
1133741945 16:8658526-8658548 TCTGGAGCCGAGGAGCAACCGGG - Intergenic
1134849320 16:17468131-17468153 TCTGGTCTCCTGGAGCTCCATGG + Intronic
1135392370 16:22104594-22104616 TCTTGAGCCCAGGAGCCTCAAGG + Intronic
1135412981 16:22249007-22249029 TCTATTGCCCAGGAGCACAGTGG + Intronic
1136393894 16:29982621-29982643 TCTGGGGCCCACGCCCACCACGG - Intronic
1137675942 16:50303976-50303998 TCTGGTTCCAAGGAGCCTCAAGG + Intronic
1138029215 16:53546498-53546520 TCTGATGCCAAGAAGCACCTGGG - Intergenic
1139375242 16:66492856-66492878 GCTGGTGCCGAGGGACACCAGGG - Intronic
1139796008 16:69483427-69483449 TCTGTTGCCCAGGAGTGCAATGG - Intergenic
1139922776 16:70470384-70470406 TCTGGGCCCCAGGAGCCCCGGGG - Exonic
1141143134 16:81510234-81510256 ACAGCTGCCCAGGAGCTCCACGG + Intronic
1141158141 16:81611006-81611028 TCTGCTGACTAGGAGCACTAAGG - Intronic
1141505027 16:84471349-84471371 CCTGGGGCTCAGCAGCACCAGGG + Intergenic
1141720892 16:85754694-85754716 TCTGGTGCCCATGAGGGGCAGGG - Intergenic
1142292158 16:89198165-89198187 CATGGTGCCCAGCAGCAGCACGG + Exonic
1142880367 17:2878770-2878792 CCTGCTGCCCAGGAGCCCCACGG + Intronic
1143644833 17:8223467-8223489 TCTGGGGCCCAGAAGACCCACGG + Intergenic
1144903947 17:18625028-18625050 TCTGGTGCCCGGAGGCCCCATGG - Intergenic
1145195986 17:20895601-20895623 TCTGGTGCCCACAGGCCCCACGG - Intronic
1146929819 17:36769047-36769069 TCTGGAGCCCAGGGGCAAGATGG + Intergenic
1146968610 17:37054213-37054235 CCTGGGGCCCAGGAGCAGCATGG - Intronic
1147420121 17:40318362-40318384 CCTGATGCCGAGCAGCACCAGGG + Intronic
1147983915 17:44293301-44293323 TCTGTTGCCCAGGAGTGCAATGG - Intergenic
1148576509 17:48715598-48715620 TCTGGTGCCCAATAGCATAAAGG + Intergenic
1149434993 17:56626115-56626137 TCTGGTGCCCAGGAGGACAAGGG - Intergenic
1149600893 17:57892363-57892385 TCTGCCCCCCAGGAGGACCAGGG + Intronic
1151326065 17:73380430-73380452 TCTGGTGCACGGGAGGACGACGG + Intronic
1151658864 17:75508269-75508291 TGTGGAGCCCAGGAGCTCTAGGG + Exonic
1152025384 17:77805557-77805579 TCTGTTGCCCAGGAGTACAGTGG - Intergenic
1153649719 18:7229340-7229362 TCAGGGTCCCAGGAGCAGCAGGG + Intergenic
1156481229 18:37437565-37437587 TCTTGTGTCCTGGAGGACCAAGG + Intronic
1156482822 18:37446809-37446831 TGTGCTGCCCAGCAACACCATGG - Intronic
1158932405 18:62334498-62334520 TCTGCTGCCCTGGGGCTCCAAGG - Intronic
1160533375 18:79578081-79578103 CCTGGTGTCCATGAGCACCCAGG - Intergenic
1160534266 18:79584022-79584044 TCCTATGCCCAGGAGCACCCGGG - Intergenic
1160544731 18:79645410-79645432 TCTGCTGCCCAGCAGCAGGAAGG + Intergenic
1160983345 19:1826706-1826728 TCAGGAGCTCAGGAGCACCCGGG - Intronic
1161095783 19:2389812-2389834 CCTCGTGCCCAGGACAACCAAGG + Exonic
1161439805 19:4284551-4284573 TCTGGTGGCAAGGAGCACAAGGG - Intronic
1161583355 19:5092473-5092495 TCTGCTGCCCAGGAGCTCCGGGG + Intronic
1162027198 19:7901049-7901071 TCTGGGGCCCAGGAGGATCTGGG + Exonic
1162029361 19:7910712-7910734 GCAGGTGCCCATGAGCTCCATGG - Exonic
1162044513 19:7989586-7989608 TCTGGTGCTCAGGAATATCAAGG + Intronic
1162461898 19:10818372-10818394 GCTGGTGCCCATGAGCACCCGGG - Intronic
1163234599 19:16023190-16023212 TTCAGTGCCCTGGAGCACCAGGG - Intergenic
1164394413 19:27850892-27850914 TCTGTTGCCCAGGTCTACCAGGG + Intergenic
1164400782 19:27900742-27900764 TTTGGTGCCCAGGAGTGGCAAGG - Intergenic
1164564676 19:29317236-29317258 TCTGCTGCCCAAGAGAACCCGGG - Intergenic
1165247289 19:34504935-34504957 TGTGGGGCCCAGGAGAACCTTGG + Exonic
1165388274 19:35524433-35524455 CCTGGCTCCCAGGGGCACCAGGG + Intronic
1166416764 19:42600930-42600952 TCCTGTCCCCAGCAGCACCAAGG - Intronic
925134629 2:1517734-1517756 TTTGGTGCTCAAGAGCAGCAAGG - Intronic
925774592 2:7322177-7322199 TCTGGTAGCAAAGAGCACCAAGG - Intergenic
926657396 2:15423566-15423588 TCTGGTGAGCAGCAGTACCATGG - Intronic
926989754 2:18665593-18665615 TCTGTTGCCCAGGAGTACAGTGG + Intergenic
928169486 2:28994216-28994238 TCAGGTGAGAAGGAGCACCAAGG + Intronic
931260912 2:60618306-60618328 TTTGGAGCCCAGGAGCAACAGGG + Intergenic
932363082 2:71126065-71126087 GCTTGAGCCCAGGAGCAACATGG - Intronic
932856577 2:75240714-75240736 CTTCGTGCCCAGGAGCTCCAAGG - Intergenic
933283027 2:80353807-80353829 TTTAGTGCCCTGGAGCAGCAAGG + Intronic
933792450 2:85893920-85893942 TCTGCTGCCCTGAAGCACAAAGG + Intergenic
935115829 2:100135540-100135562 TCTGGTGCCTTGGAGCTCCTTGG - Intronic
935950249 2:108322255-108322277 GCTGGTGCCCAAGACCACCGTGG + Intergenic
936156072 2:110048206-110048228 TCTGGTGCCCAGAGCCACCAGGG - Intergenic
936188616 2:110323222-110323244 TCTGGTGCCCAGAGCCACCAGGG + Intergenic
937199507 2:120189915-120189937 ACTGGTTCCCAGGAGCAGAAGGG + Intergenic
937620384 2:123978626-123978648 CCACCTGCCCAGGAGCACCAGGG + Intergenic
938043460 2:128095552-128095574 TCTGTTGCCCAGATGCAGCATGG + Intronic
938266343 2:129930862-129930884 TGTGGAGCCCAGAAGCCCCAGGG + Intergenic
938293414 2:130162243-130162265 CCTGCTGCCCTGCAGCACCACGG + Intronic
938463140 2:131510718-131510740 GCTGCTGCCCTGCAGCACCACGG - Intergenic
938913931 2:135915367-135915389 ACTTGTGCCCAGGAGTATCAAGG - Intronic
944425098 2:199572893-199572915 TATGGGGCTGAGGAGCACCAGGG + Intergenic
945766882 2:213991558-213991580 GCGGGGGTCCAGGAGCACCAGGG - Intronic
947603153 2:231467124-231467146 TCTGCTGCCCCTGAGCTCCAAGG + Intronic
947986129 2:234449095-234449117 TCAAGTGCTCAGGAGCTCCATGG - Intergenic
948378984 2:237540286-237540308 TCTGGAGCCATGGAGCTCCAGGG - Intronic
1168940780 20:1709352-1709374 GCTGGGTCCCAGGAGGACCAGGG - Intergenic
1169003346 20:2184630-2184652 TCATCTGCCCAGGAGAACCAAGG - Intergenic
1169025957 20:2371782-2371804 TCTGGAACCCAGCAGGACCAGGG - Intergenic
1169204904 20:3733933-3733955 TCATGTCCCCAGGAGCACTATGG - Intronic
1169572966 20:6926645-6926667 TCTGGTGCTCAGGATCACCCAGG - Intergenic
1171153054 20:22844619-22844641 TCTGGTGCCAAAGAGGCCCAAGG - Intergenic
1171312004 20:24152085-24152107 GCTGTTTCCCAGGAGCACAATGG + Intergenic
1171517718 20:25750885-25750907 TCTGCACCCCAGGAGCACCCCGG - Intergenic
1172376335 20:34443944-34443966 TCTGTTGCCCAGGAGTACAGTGG - Intronic
1172728688 20:37068561-37068583 TTTCGTTCCCAGGATCACCAGGG + Intronic
1173715544 20:45200281-45200303 TCTGGTGGGGATGAGCACCATGG + Intergenic
1173781088 20:45758202-45758224 TCTGGTGCCCATGAGCTCCAAGG - Intronic
1174503840 20:51004272-51004294 CATGGTCCCCAGGAGCACCCCGG - Exonic
1174603451 20:51743203-51743225 TCTGGAACCCTGGGGCACCAGGG - Intronic
1175265660 20:57701985-57702007 TTTGGGGCCCAGGAGCACCCTGG - Intronic
1175950011 20:62578392-62578414 TCTGGTGCCCATTAGCACCAAGG + Intergenic
1176276860 20:64277543-64277565 CCTGATGCCCAGCAGCAGCAGGG - Intronic
1178480616 21:32976886-32976908 GCTGGAGTCCAAGAGCACCAAGG + Intergenic
1178720910 21:35008073-35008095 ATTGGTGCCAAGGAGCACCATGG - Intronic
1178763080 21:35422641-35422663 GCTGGTGCCCAGGAGAGCCAGGG + Intronic
1180007131 21:45028012-45028034 TCTGGGGCCCAGGGGGAGCAGGG - Intergenic
1181054449 22:20253522-20253544 ACTGGTATCCAGGAGCACCCAGG + Intronic
1181291926 22:21801490-21801512 TCTGTTGCCCAGGAGTACAGTGG - Intronic
1182252775 22:29014725-29014747 TCTACTGACCAGGAGCCCCATGG - Intronic
1182358835 22:29734978-29735000 TGGGGTGCCCAGGAGAGCCAGGG + Intronic
1182743261 22:32584342-32584364 TCTGATGCCGGGGAGCAGCAAGG + Intronic
1183032034 22:35113678-35113700 GCTGGTGCTCAGTGGCACCAGGG - Intergenic
1183032209 22:35114761-35114783 GCTGGTGCTCAGTGGCACCACGG + Intergenic
1183276427 22:36900952-36900974 TCTGGGGGTCAGGAGCACCAGGG - Intergenic
1183829767 22:40411557-40411579 TCCTGAGCCCAGCAGCACCATGG - Exonic
1183933910 22:41250947-41250969 CCTGGGGCCCACGAGCATCAAGG + Intronic
1184438671 22:44495936-44495958 TTTGCTGCCCAGGATCTCCATGG - Exonic
1184827088 22:46959643-46959665 TCTGGTGCCCAGGATTGCCATGG + Intronic
1184867398 22:47209348-47209370 GCTGGTGGCCAGGAGGAACATGG - Intergenic
1184901913 22:47451595-47451617 GCTGGTGCCCAGATGGACCAGGG - Intergenic
1185002348 22:48253637-48253659 TCTGGTGGCCAGGAAGACAAAGG + Intergenic
1185059570 22:48599248-48599270 GCTGGTGGCCAGGAAGACCAAGG - Intronic
1185173759 22:49307651-49307673 TCTGGCCCCCAGAAGCCCCAGGG + Intergenic
949905012 3:8852080-8852102 TCTGGAGCCCAGGACCTCTAGGG - Intronic
949935533 3:9112859-9112881 TCTGGTGCCCAGGCCAACCTGGG + Intronic
950205827 3:11079784-11079806 TCTGGTGCCCAGTACCAGAAAGG + Intergenic
951718582 3:25674377-25674399 TCTGGTTCCCAAGAGCACAGGGG + Intergenic
951722211 3:25712357-25712379 ACTGATGCCCAGGAACCCCATGG + Intergenic
952520293 3:34150193-34150215 TCTGGTTCCTGGGACCACCAGGG - Intergenic
955479459 3:59374700-59374722 TCTGTTGCCCAGCATCACCAAGG + Intergenic
955720009 3:61870349-61870371 TCTGTTGCCCAGGAGTGCAATGG + Intronic
958945801 3:100360540-100360562 TCTGTTGCCCAGGAGTACAGTGG - Intergenic
959603924 3:108222031-108222053 ACTGGTTCCCAGCAGGACCAAGG + Intronic
960805628 3:121581013-121581035 TCTGTTGCCCAGGAGTGCAATGG + Intronic
961398572 3:126616585-126616607 TCTGGGGCCCAGCAGCACAGTGG - Intronic
961526288 3:127500427-127500449 TGTGATGCACAGGAGCACCTGGG - Intergenic
962388116 3:134949276-134949298 TCTGGGGTCCAGGAGGACCCTGG + Intronic
964955980 3:162356229-162356251 TCTGGAGCCCAGGGCCACTAGGG - Intergenic
965716868 3:171614162-171614184 TCTGTTACCCAGGGCCACCATGG - Intronic
966619868 3:181952333-181952355 TCTGGTGCCCAGGAGCACCATGG + Intergenic
968613181 4:1566280-1566302 CACGGTGCCCAGGAGCACCAGGG + Intergenic
969429375 4:7145267-7145289 TCAGCTGCCCAGGGGCAGCAGGG - Intergenic
969612942 4:8237157-8237179 CCTGGTGCCCAGGAGCGCGTGGG + Intronic
969849244 4:9943478-9943500 TCGGGGGCCCAGGAGGGCCAGGG + Intronic
970433476 4:16010716-16010738 TCTTGAGCCCAGGAGCAACATGG - Intronic
970560116 4:17274396-17274418 TCTTGAGCCCAGGAGCACTGAGG + Intergenic
970688519 4:18595425-18595447 TCTGGTACCCAGGAGGACACAGG - Intergenic
971083541 4:23243913-23243935 TCTGGGGCCAAGAAGCCCCAAGG + Intergenic
971320058 4:25598390-25598412 TCTGGAGCCCAGGAGGTCAAGGG + Intergenic
972396961 4:38665128-38665150 TCTGGAGCCCAGGAGCTGCCAGG + Intronic
977482123 4:97592702-97592724 TCTGGTGCACAGTAGCCCCATGG - Intronic
978786504 4:112615671-112615693 CTTGTTGCCCAGGAGCACAATGG + Intronic
979773921 4:124563534-124563556 TCTGGTACCCAGGAAAACAAGGG - Intergenic
979822588 4:125192192-125192214 TCTGGTGCACAGGAGCCCATGGG - Intergenic
980985475 4:139690828-139690850 TCTGGTAACCAGGAGCAGTAAGG - Intronic
981661968 4:147178121-147178143 TCTGGAACCCAGGAGGCCCATGG - Intergenic
982861517 4:160456815-160456837 TCTGGAAATCAGGAGCACCAAGG - Intergenic
985614483 5:911213-911235 TCTGGTGCCCACCACCACCTGGG - Intronic
985676280 5:1232852-1232874 TCCGGTGGGCAGGAGCTCCAGGG - Exonic
986030457 5:3888585-3888607 TCTGGCCCCAAGGAGCACCTGGG - Intergenic
987667735 5:20966412-20966434 ACAGGTGCCCAGCTGCACCATGG + Intergenic
987844269 5:23261623-23261645 TCTGATGCACAGGAGCAGAAAGG + Intergenic
988706946 5:33735827-33735849 TCTGGTGCCCAGGAACATCCTGG + Intronic
989338606 5:40348877-40348899 TCTGGTGCCCACTTTCACCATGG + Intergenic
990258747 5:53998831-53998853 TTTGGTGCCAATGAGAACCAGGG + Intronic
990330705 5:54722775-54722797 TCTGTTGCCCAGGAGCACAGTGG + Intergenic
990988863 5:61665834-61665856 TCTACTGCCCAGAAGCATCATGG + Intronic
994705987 5:103207087-103207109 TCTGGTGCTCAGGACCCCCTGGG - Intronic
996821316 5:127631821-127631843 TCTGGTGCCCAGGAGAGATATGG - Intergenic
998329333 5:141309953-141309975 TCTGGTGGCCAGAAAGACCAAGG - Intergenic
998521795 5:142807730-142807752 GCTGATACCCATGAGCACCAGGG - Intronic
999301896 5:150496457-150496479 GCTGCTGCCCAGGAGCCCAAGGG + Intronic
1001388244 5:171357643-171357665 TCTTGTCCCTAGGAACACCAGGG - Intergenic
1002174544 5:177394094-177394116 GCAGGTGCACAGCAGCACCAGGG - Exonic
1002255103 5:177952760-177952782 TCCGGTGCACAGGGGCTCCAGGG - Intergenic
1002999734 6:2319733-2319755 TCTGGTGCCCAAGAGGAATAAGG + Intergenic
1003057947 6:2840446-2840468 TCTGGTCCCCAGAAAAACCATGG + Exonic
1003890237 6:10557568-10557590 GCTGGAGCCCAGGAGGTCCAGGG - Intronic
1005385928 6:25284112-25284134 TCTGGTGCCCAGCAGCCTCTGGG - Intronic
1006425860 6:33962656-33962678 TCTGGAGCCCAGGAAACCCAGGG - Intergenic
1007645495 6:43377248-43377270 TCTGGTCCCCCAGATCACCATGG + Intergenic
1009813464 6:68700156-68700178 TCAGGTGCCTAGGTGGACCAGGG + Intronic
1010830935 6:80528158-80528180 TCTTGGCCCCTGGAGCACCATGG - Intergenic
1013077492 6:106784237-106784259 TTTGGTGCCCAGGATCCCAAGGG + Intergenic
1013630450 6:111981116-111981138 TCTTGTCCCGAGGAGCTCCAGGG - Intergenic
1017805241 6:157940076-157940098 GCTGGTGCTCAGGGGCAGCAAGG + Intronic
1019411162 7:907373-907395 CCCAGAGCCCAGGAGCACCAGGG + Intronic
1020013904 7:4820304-4820326 CCGGGAGCCCAGGAGCCCCAGGG + Intronic
1020176878 7:5889053-5889075 TATGGTGGCCAGAAGCCCCATGG - Intergenic
1022274374 7:28841365-28841387 TCTTCTCCCCAGCAGCACCATGG - Intergenic
1022495451 7:30850301-30850323 CCTGCAGCCCAGGAGCCCCAAGG - Intronic
1025924869 7:65949581-65949603 ACTTGAGCCCAGGAGCAACATGG + Intronic
1027946189 7:84748857-84748879 TCTGAAGCCTAGGACCACCAGGG - Intergenic
1031402460 7:121341967-121341989 TTGTGTTCCCAGGAGCACCATGG - Intergenic
1031986884 7:128168980-128169002 TCGGGTGGCCAGGAGCACCCAGG + Intergenic
1033149280 7:138899261-138899283 TCAGGGGCCCAGAATCACCATGG + Intronic
1033215634 7:139491433-139491455 ACAAGTGCCCAGGAGCACCTTGG + Intergenic
1033502447 7:141965603-141965625 TCTTGTGGCCATGACCACCATGG + Intronic
1033754264 7:144384981-144385003 CCTGGTGCTCAGGAGCCCCTTGG - Intergenic
1034576716 7:152006119-152006141 TCTGGTTCCCTGGAGGCCCAGGG + Intronic
1035748410 8:1978325-1978347 TCTGGTGCTGAGTGGCACCAAGG - Intronic
1036221629 8:6925908-6925930 GCTGATGCCCAGGAGCAGCGTGG - Exonic
1039479147 8:37858783-37858805 CCTGGTTCCCAGGAGTCCCAAGG - Intronic
1040728237 8:50409602-50409624 TCAGCTCCCCTGGAGCACCAGGG - Intronic
1042411806 8:68474867-68474889 CTTGGTGCCCAGGAGAAGCAAGG + Intronic
1042458123 8:69029235-69029257 AGTGCTGCCAAGGAGCACCAAGG + Intergenic
1044329780 8:90903999-90904021 TTTGGTGCCCTGGATCACTAGGG - Intronic
1044834629 8:96283723-96283745 CCAGCTGCCCAGGAGCTCCAGGG - Intronic
1046678417 8:117138655-117138677 TCTCTAGCCCAGGAGCAGCAAGG + Intronic
1047348793 8:124053884-124053906 TCTGGTGCATAGGAGAACAAAGG - Intronic
1047725153 8:127678106-127678128 TCTGCTTCCCAGCAGGACCAGGG + Intergenic
1048953274 8:139513625-139513647 TCTGGTGCTGAGGAGACCCAGGG - Intergenic
1049093429 8:140534078-140534100 TCCGCTGCCCACCAGCACCAGGG - Intronic
1049272319 8:141702514-141702536 TATCGTGCCCAGGAAAACCAGGG - Intergenic
1049649884 8:143760975-143760997 TGCGGAGCGCAGGAGCACCAGGG + Intergenic
1049686414 8:143941036-143941058 TCTTGTGCCCAAGGGCACCCCGG + Intronic
1050673734 9:8028030-8028052 TCGAGTGCTCAGTAGCACCAAGG + Intergenic
1051159070 9:14185407-14185429 TCTGGTCCCCATCAGCACCTGGG + Intronic
1054798604 9:69325320-69325342 GCAGGAGCCCGGGAGCACCACGG - Intronic
1055787182 9:79883702-79883724 TGTGATGCCCAGGAGCACCTGGG - Intergenic
1056186721 9:84142215-84142237 TCTGGAGGCCAGAAGCCCCACGG - Intergenic
1056954976 9:91074415-91074437 CCTGGTTCCCAGGAGCCCCTGGG - Intergenic
1057049767 9:91914789-91914811 TCAGGTGCTCAGGAGCAGGAAGG - Intronic
1057405817 9:94769799-94769821 TCAGGTGCCCAGATGCACAATGG + Intronic
1057422901 9:94926665-94926687 CCTGCTGGCCAGGAGCACCTGGG - Intronic
1058547649 9:106077924-106077946 TGTGGTGAGCAGCAGCACCAGGG - Intergenic
1058756610 9:108088581-108088603 GCTGGTGCCCACGAGAACTAAGG - Intergenic
1059081777 9:111257570-111257592 TATGTTGCCCAGGAACACCTGGG - Intergenic
1060209460 9:121700856-121700878 CCTGGTCCCCTGGGGCACCAGGG - Intronic
1061856792 9:133445830-133445852 GCTGGTCCCCAGGAGCATCCCGG - Intronic
1187055814 X:15740676-15740698 TCTGGTGCTCAGGAGCAGTCAGG - Intronic
1189280868 X:39819504-39819526 TCTGGTCCTCAGGAGACCCATGG - Intergenic
1192395265 X:70774162-70774184 CCTGGGGCCCAGCAGCACCAGGG + Intronic
1196577713 X:117339341-117339363 TCTAGTGCCCAGTACTACCATGG + Intergenic
1197064338 X:122220773-122220795 TCAGGGGCCCAGGACCAGCATGG + Intergenic
1199926078 X:152465644-152465666 CCTGGTGCCCAGGAACACTGGGG - Intergenic
1200057914 X:153471040-153471062 CCTGGTTCCCAGGAGGACCAAGG + Intronic
1200067753 X:153512326-153512348 TCTGGCGCCCTGGAGAACCCTGG + Intergenic