ID: 966623870

View in Genome Browser
Species Human (GRCh38)
Location 3:181995593-181995615
Sequence ATGGTTAAAGAGTTGTGACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966623870_966623874 21 Left 966623870 3:181995593-181995615 CCATGTCACAACTCTTTAACCAT No data
Right 966623874 3:181995637-181995659 TGTGATCTTTTGAAAGTTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966623870 Original CRISPR ATGGTTAAAGAGTTGTGACA TGG (reversed) Intergenic
No off target data available for this crispr