ID: 966624939

View in Genome Browser
Species Human (GRCh38)
Location 3:182005687-182005709
Sequence GGGGCTTTATGGAGACCTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 155}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966624929_966624939 4 Left 966624929 3:182005660-182005682 CCTCAGTCTACCCAAGGATATGG 0: 1
1: 0
2: 0
3: 10
4: 127
Right 966624939 3:182005687-182005709 GGGGCTTTATGGAGACCTGAGGG 0: 1
1: 0
2: 0
3: 9
4: 155
966624935_966624939 -6 Left 966624935 3:182005670-182005692 CCCAAGGATATGGAGTGGGGGCT 0: 1
1: 0
2: 0
3: 10
4: 136
Right 966624939 3:182005687-182005709 GGGGCTTTATGGAGACCTGAGGG 0: 1
1: 0
2: 0
3: 9
4: 155
966624936_966624939 -7 Left 966624936 3:182005671-182005693 CCAAGGATATGGAGTGGGGGCTT 0: 1
1: 0
2: 0
3: 5
4: 155
Right 966624939 3:182005687-182005709 GGGGCTTTATGGAGACCTGAGGG 0: 1
1: 0
2: 0
3: 9
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966624939 Original CRISPR GGGGCTTTATGGAGACCTGA GGG Intergenic