ID: 966625554

View in Genome Browser
Species Human (GRCh38)
Location 3:182012469-182012491
Sequence CTGTGAAATGGGCAGATGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966625554_966625559 18 Left 966625554 3:182012469-182012491 CCCACCATCTGCCCATTTCACAG No data
Right 966625559 3:182012510-182012532 CGATAATAAATTATTAGTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966625554 Original CRISPR CTGTGAAATGGGCAGATGGT GGG (reversed) Intergenic
No off target data available for this crispr