ID: 966626548

View in Genome Browser
Species Human (GRCh38)
Location 3:182022974-182022996
Sequence CTGAATTTGTTTGAGCTGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966626548_966626549 21 Left 966626548 3:182022974-182022996 CCATACAGCTCAAACAAATTCAG No data
Right 966626549 3:182023018-182023040 CTGACACTTTGAAAATTTAGAGG No data
966626548_966626550 22 Left 966626548 3:182022974-182022996 CCATACAGCTCAAACAAATTCAG No data
Right 966626550 3:182023019-182023041 TGACACTTTGAAAATTTAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966626548 Original CRISPR CTGAATTTGTTTGAGCTGTA TGG (reversed) Intergenic
No off target data available for this crispr