ID: 966629752

View in Genome Browser
Species Human (GRCh38)
Location 3:182059367-182059389
Sequence CTCGAATCCTAGAATTATAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966629748_966629752 21 Left 966629748 3:182059323-182059345 CCACAGGAGTCCAGCTTGCCTGT No data
Right 966629752 3:182059367-182059389 CTCGAATCCTAGAATTATAAAGG No data
966629750_966629752 11 Left 966629750 3:182059333-182059355 CCAGCTTGCCTGTAATGCAGGTA No data
Right 966629752 3:182059367-182059389 CTCGAATCCTAGAATTATAAAGG No data
966629747_966629752 22 Left 966629747 3:182059322-182059344 CCCACAGGAGTCCAGCTTGCCTG No data
Right 966629752 3:182059367-182059389 CTCGAATCCTAGAATTATAAAGG No data
966629751_966629752 3 Left 966629751 3:182059341-182059363 CCTGTAATGCAGGTATTAGTCAT No data
Right 966629752 3:182059367-182059389 CTCGAATCCTAGAATTATAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966629752 Original CRISPR CTCGAATCCTAGAATTATAA AGG Intergenic
No off target data available for this crispr