ID: 966637010

View in Genome Browser
Species Human (GRCh38)
Location 3:182146644-182146666
Sequence GGCTTAAGGGGACAAGGATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966637010_966637021 28 Left 966637010 3:182146644-182146666 CCAGATCCTTGTCCCCTTAAGCC No data
Right 966637021 3:182146695-182146717 AACAGGAAACACTCAGGCAAAGG No data
966637010_966637019 22 Left 966637010 3:182146644-182146666 CCAGATCCTTGTCCCCTTAAGCC No data
Right 966637019 3:182146689-182146711 AAGACCAACAGGAAACACTCAGG No data
966637010_966637018 11 Left 966637010 3:182146644-182146666 CCAGATCCTTGTCCCCTTAAGCC No data
Right 966637018 3:182146678-182146700 CTGTCATAGTGAAGACCAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966637010 Original CRISPR GGCTTAAGGGGACAAGGATC TGG (reversed) Intergenic
No off target data available for this crispr