ID: 966638797

View in Genome Browser
Species Human (GRCh38)
Location 3:182165559-182165581
Sequence CCAGAACTGCAGAGAGAACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966638795_966638797 0 Left 966638795 3:182165536-182165558 CCTGCTTTACTCATGACTGTATG No data
Right 966638797 3:182165559-182165581 CCAGAACTGCAGAGAGAACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966638797 Original CRISPR CCAGAACTGCAGAGAGAACC TGG Intergenic
No off target data available for this crispr