ID: 966640310

View in Genome Browser
Species Human (GRCh38)
Location 3:182182497-182182519
Sequence CTTACTTACATATTTACAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966640308_966640310 -5 Left 966640308 3:182182479-182182501 CCTTTTGACAAAATTCCACTTAC No data
Right 966640310 3:182182497-182182519 CTTACTTACATATTTACAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966640310 Original CRISPR CTTACTTACATATTTACAGA AGG Intergenic
No off target data available for this crispr