ID: 966645032

View in Genome Browser
Species Human (GRCh38)
Location 3:182236233-182236255
Sequence AAATAAAAGCCTCAGTTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966645027_966645032 -8 Left 966645027 3:182236218-182236240 CCAACCGATACCTAAAAATAAAA No data
Right 966645032 3:182236233-182236255 AAATAAAAGCCTCAGTTGGGTGG No data
966645026_966645032 16 Left 966645026 3:182236194-182236216 CCTTACACAACTCTGATTAACTT No data
Right 966645032 3:182236233-182236255 AAATAAAAGCCTCAGTTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966645032 Original CRISPR AAATAAAAGCCTCAGTTGGG TGG Intergenic
No off target data available for this crispr