ID: 966651069

View in Genome Browser
Species Human (GRCh38)
Location 3:182301683-182301705
Sequence AATTATCCAGAGATGTTGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966651069_966651070 11 Left 966651069 3:182301683-182301705 CCTTGCAACATCTCTGGATAATT No data
Right 966651070 3:182301717-182301739 TGTCTAATTATTCCTACAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966651069 Original CRISPR AATTATCCAGAGATGTTGCA AGG (reversed) Intergenic
No off target data available for this crispr