ID: 966653623

View in Genome Browser
Species Human (GRCh38)
Location 3:182328176-182328198
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966653618_966653623 28 Left 966653618 3:182328125-182328147 CCAAGGCACAGGCTTTCTAAGAA No data
Right 966653623 3:182328176-182328198 CACTGGTCTTAAAGGGAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr