ID: 966654223

View in Genome Browser
Species Human (GRCh38)
Location 3:182335884-182335906
Sequence GTGGTGATTTTTAATTTAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966654223_966654227 16 Left 966654223 3:182335884-182335906 CCACTTAAATTAAAAATCACCAC No data
Right 966654227 3:182335923-182335945 ACTAAAAAAAAACATTGCAGTGG No data
966654223_966654228 25 Left 966654223 3:182335884-182335906 CCACTTAAATTAAAAATCACCAC No data
Right 966654228 3:182335932-182335954 AAACATTGCAGTGGAGTTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966654223 Original CRISPR GTGGTGATTTTTAATTTAAG TGG (reversed) Intergenic
No off target data available for this crispr