ID: 966654800

View in Genome Browser
Species Human (GRCh38)
Location 3:182343833-182343855
Sequence TGTTCTTTGCAGCACATGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966654800_966654803 16 Left 966654800 3:182343833-182343855 CCATCCATGTGCTGCAAAGAACA No data
Right 966654803 3:182343872-182343894 TATGGCTGTGTAGTGTTCCATGG 0: 23
1: 701
2: 3272
3: 28450
4: 15109
966654800_966654802 -2 Left 966654800 3:182343833-182343855 CCATCCATGTGCTGCAAAGAACA No data
Right 966654802 3:182343854-182343876 CATGATTTTGTTCTTTTTTATGG 0: 181
1: 829
2: 2706
3: 5480
4: 11086
966654800_966654804 23 Left 966654800 3:182343833-182343855 CCATCCATGTGCTGCAAAGAACA No data
Right 966654804 3:182343879-182343901 GTGTAGTGTTCCATGGTGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966654800 Original CRISPR TGTTCTTTGCAGCACATGGA TGG (reversed) Intergenic
No off target data available for this crispr