ID: 966656321

View in Genome Browser
Species Human (GRCh38)
Location 3:182362437-182362459
Sequence CCTCATTGAAACCAGCCCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966656317_966656321 23 Left 966656317 3:182362391-182362413 CCAATAATTGCTACCAGCTAAAT No data
Right 966656321 3:182362437-182362459 CCTCATTGAAACCAGCCCTGTGG No data
966656319_966656321 10 Left 966656319 3:182362404-182362426 CCAGCTAAATCTGGTTTCATCAT No data
Right 966656321 3:182362437-182362459 CCTCATTGAAACCAGCCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966656321 Original CRISPR CCTCATTGAAACCAGCCCTG TGG Intergenic
No off target data available for this crispr