ID: 966657063

View in Genome Browser
Species Human (GRCh38)
Location 3:182371194-182371216
Sequence AGGTGCAGCCTGGGCATTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966657063_966657068 3 Left 966657063 3:182371194-182371216 CCCACAATGCCCAGGCTGCACCT No data
Right 966657068 3:182371220-182371242 ATCAAACAAATTAGAATCTCTGG No data
966657063_966657070 10 Left 966657063 3:182371194-182371216 CCCACAATGCCCAGGCTGCACCT No data
Right 966657070 3:182371227-182371249 AAATTAGAATCTCTGGAAATGGG No data
966657063_966657069 9 Left 966657063 3:182371194-182371216 CCCACAATGCCCAGGCTGCACCT No data
Right 966657069 3:182371226-182371248 CAAATTAGAATCTCTGGAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966657063 Original CRISPR AGGTGCAGCCTGGGCATTGT GGG (reversed) Intergenic
No off target data available for this crispr