ID: 966660335

View in Genome Browser
Species Human (GRCh38)
Location 3:182407779-182407801
Sequence TGTTTGCCTTAGAAGTGGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966660330_966660335 20 Left 966660330 3:182407736-182407758 CCTCCAATGCTTGAGTTTATTTC No data
Right 966660335 3:182407779-182407801 TGTTTGCCTTAGAAGTGGAGTGG No data
966660331_966660335 17 Left 966660331 3:182407739-182407761 CCAATGCTTGAGTTTATTTCTTC No data
Right 966660335 3:182407779-182407801 TGTTTGCCTTAGAAGTGGAGTGG No data
966660333_966660335 -10 Left 966660333 3:182407766-182407788 CCAGGTTTTGTTATGTTTGCCTT No data
Right 966660335 3:182407779-182407801 TGTTTGCCTTAGAAGTGGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966660335 Original CRISPR TGTTTGCCTTAGAAGTGGAG TGG Intergenic
No off target data available for this crispr