ID: 966661310

View in Genome Browser
Species Human (GRCh38)
Location 3:182417979-182418001
Sequence AGTTATCTGCAAATGATGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966661310_966661314 16 Left 966661310 3:182417979-182418001 CCTGCCATCATTTGCAGATAACT No data
Right 966661314 3:182418018-182418040 ACAGGTATTGCCCTGCTACTTGG No data
966661310_966661312 -2 Left 966661310 3:182417979-182418001 CCTGCCATCATTTGCAGATAACT No data
Right 966661312 3:182418000-182418022 CTATTCTCCTTTTGAGATACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966661310 Original CRISPR AGTTATCTGCAAATGATGGC AGG (reversed) Intergenic
No off target data available for this crispr