ID: 966665052

View in Genome Browser
Species Human (GRCh38)
Location 3:182463200-182463222
Sequence CCTTTCAGCCATGAGTGGAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966665052_966665062 12 Left 966665052 3:182463200-182463222 CCGCTCCACTCATGGCTGAAAGG No data
Right 966665062 3:182463235-182463257 GCTTGGGCCATGGCTTCAGAGGG 0: 110
1: 317
2: 720
3: 1144
4: 1940
966665052_966665058 -4 Left 966665052 3:182463200-182463222 CCGCTCCACTCATGGCTGAAAGG No data
Right 966665058 3:182463219-182463241 AAGGGGCCAACATAGAGCTTGGG 0: 58
1: 243
2: 464
3: 870
4: 1529
966665052_966665057 -5 Left 966665052 3:182463200-182463222 CCGCTCCACTCATGGCTGAAAGG No data
Right 966665057 3:182463218-182463240 AAAGGGGCCAACATAGAGCTTGG 0: 84
1: 179
2: 267
3: 585
4: 822
966665052_966665061 11 Left 966665052 3:182463200-182463222 CCGCTCCACTCATGGCTGAAAGG No data
Right 966665061 3:182463234-182463256 AGCTTGGGCCATGGCTTCAGAGG 0: 104
1: 314
2: 756
3: 1216
4: 1535
966665052_966665060 2 Left 966665052 3:182463200-182463222 CCGCTCCACTCATGGCTGAAAGG No data
Right 966665060 3:182463225-182463247 CCAACATAGAGCTTGGGCCATGG 0: 19
1: 55
2: 160
3: 349
4: 650

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966665052 Original CRISPR CCTTTCAGCCATGAGTGGAG CGG (reversed) Intergenic
No off target data available for this crispr