ID: 966665057

View in Genome Browser
Species Human (GRCh38)
Location 3:182463218-182463240
Sequence AAAGGGGCCAACATAGAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1937
Summary {0: 84, 1: 179, 2: 267, 3: 585, 4: 822}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966665051_966665057 -1 Left 966665051 3:182463196-182463218 CCAGCCGCTCCACTCATGGCTGA No data
Right 966665057 3:182463218-182463240 AAAGGGGCCAACATAGAGCTTGG 0: 84
1: 179
2: 267
3: 585
4: 822
966665056_966665057 -10 Left 966665056 3:182463205-182463227 CCACTCATGGCTGAAAGGGGCCA No data
Right 966665057 3:182463218-182463240 AAAGGGGCCAACATAGAGCTTGG 0: 84
1: 179
2: 267
3: 585
4: 822
966665050_966665057 0 Left 966665050 3:182463195-182463217 CCCAGCCGCTCCACTCATGGCTG No data
Right 966665057 3:182463218-182463240 AAAGGGGCCAACATAGAGCTTGG 0: 84
1: 179
2: 267
3: 585
4: 822
966665047_966665057 23 Left 966665047 3:182463172-182463194 CCTAGGGACTTGGTGCCTTGCAT 0: 13
1: 266
2: 479
3: 824
4: 1089
Right 966665057 3:182463218-182463240 AAAGGGGCCAACATAGAGCTTGG 0: 84
1: 179
2: 267
3: 585
4: 822
966665048_966665057 8 Left 966665048 3:182463187-182463209 CCTTGCATCCCAGCCGCTCCACT No data
Right 966665057 3:182463218-182463240 AAAGGGGCCAACATAGAGCTTGG 0: 84
1: 179
2: 267
3: 585
4: 822
966665052_966665057 -5 Left 966665052 3:182463200-182463222 CCGCTCCACTCATGGCTGAAAGG No data
Right 966665057 3:182463218-182463240 AAAGGGGCCAACATAGAGCTTGG 0: 84
1: 179
2: 267
3: 585
4: 822

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966665057 Original CRISPR AAAGGGGCCAACATAGAGCT TGG Intergenic
900815411 1:4839875-4839897 AAAGGGTCCAAGTTACAGCTTGG - Intergenic
900817330 1:4858561-4858583 AAAGGGGACAAGGTACAGCTCGG + Intergenic
900822785 1:4902046-4902068 AAAAGGGCCAAGGTACAGCTTGG - Intergenic
900889400 1:5438621-5438643 AAAGGGGCCAACATAGGGCTTGG - Intergenic
901925454 1:12563391-12563413 AAAGGCGCCAATGTACAGCTTGG + Intergenic
902084771 1:13850535-13850557 AAAGGGGCCAATGTGGAGCTTGG + Intergenic
902115314 1:14116380-14116402 ACAGGGGCCAACATAGAGCTTGG + Intergenic
902271229 1:15306638-15306660 AAAGGGGCCAACATAGAGCTTGG + Intronic
902540688 1:17152404-17152426 AAAGGGGCCCAGGTACAGCTTGG + Intergenic
903146480 1:21376039-21376061 AAGGGGGCCAAAGTACAGCTCGG + Intergenic
903221507 1:21872246-21872268 AAAGTTGCCAAAAGAGAGCTGGG + Exonic
904386174 1:30143602-30143624 AAAGGGGCCAAAGTACAGCTTGG - Intergenic
904572056 1:31473570-31473592 AAAGGGGCCAATGTAGAGCTTGG - Intergenic
905002020 1:34680048-34680070 AAAGGGGCCCAGGTACAGCTCGG - Intergenic
906020780 1:42627670-42627692 AAAGGGGCCAACTTAGCACTTGG + Intronic
906760492 1:48372847-48372869 AAAGGGGCCAATTTACAGGTTGG - Intronic
906763998 1:48409769-48409791 AAAGGGGCTAACATAGAGCTTGG - Intronic
906770034 1:48475541-48475563 TAAGGGGCCAACATAGAGATAGG + Intergenic
906833496 1:49059270-49059292 AATGGGGCCAAAGTACAGCTTGG + Intronic
907007796 1:50932956-50932978 AAATGGGCCAACATAGAGCTTGG - Intronic
907021043 1:51067063-51067085 AAAGTGGCCAATGTAGGGCTTGG - Intergenic
907392220 1:54165599-54165621 AAAGGGGCCAATGGACAGCTTGG - Intronic
907439231 1:54468620-54468642 AATGGGACCAATGTAGAGCTAGG + Intergenic
907522293 1:55032053-55032075 AAAGGGGTCAACATACAGCTTGG + Intergenic
907555884 1:55343990-55344012 AAAGGGGCCAAGGTAGAGGTTGG + Intergenic
907625148 1:56022401-56022423 AAAGGGGCCAACGTGGAGCTTGG - Intergenic
907685809 1:56609973-56609995 AAAGGAGCCAATGTAGAGCTTGG - Intronic
907771090 1:57464572-57464594 TAAGAGGCCAGCAAAGAGCTTGG + Intronic
907891614 1:58641966-58641988 CAAGGGGGCAACATAGAGGGAGG - Intergenic
907925650 1:58953191-58953213 AAAGGGGCCAACATAGAGCTTGG + Intergenic
907975643 1:59428782-59428804 AAAGGTGCCATCATAGACTTCGG - Intronic
908011892 1:59786552-59786574 AAAGGGGCCATTGTAGAGCTTGG - Intergenic
908062976 1:60371940-60371962 AAAGGGGCCTATGTACAGCTTGG + Intergenic
908118705 1:60965611-60965633 AAAGGGGCAAAGATACAGATGGG - Intronic
908487677 1:64611049-64611071 AAAGGGGCCAAGGCACAGCTTGG - Intronic
908729187 1:67208517-67208539 CAAAGGGCCAACATCCAGCTTGG + Intronic
908840313 1:68273774-68273796 AATGGGGTCAACAAAGTGCTTGG + Intergenic
908853408 1:68396151-68396173 AAAGGGACCAAGGTACAGCTTGG - Intergenic
908879030 1:68710054-68710076 AAAGGGACCAAGGTACAGCTTGG + Intergenic
908911204 1:69073612-69073634 AAAGGGGCCAAAGGAGAGCTTGG - Intergenic
908936534 1:69383370-69383392 AAAGGGGCGAACATAGAGCTTGG - Intergenic
908963531 1:69730035-69730057 AATGGGGCCAAGGTACAGCTTGG - Intronic
909057020 1:70833544-70833566 AAAGGGGGCAAGGTACAGCTTGG + Intergenic
909057935 1:70845012-70845034 AAAGGGGCCAGGGTATAGCTTGG + Intergenic
909065588 1:70931657-70931679 AAAGGGGCCAACATACAGCTTGG - Intronic
909096085 1:71290826-71290848 AAAGGGGCCAATGTAGAGCTTGG + Intergenic
909192581 1:72572967-72572989 AAAGGGGCCAATGTAGAGCTTGG + Intergenic
909250224 1:73344195-73344217 AAAGGGGCCAACTTAGAGCTTGG + Intergenic
909265959 1:73558515-73558537 AAAGGGGCCAAGCTACAGCTTGG + Intergenic
909271604 1:73629177-73629199 AAAGGGGTCAACATAGACCTTGG - Intergenic
909360789 1:74756926-74756948 AAAGGGACCAATGTAGAGCTTGG + Intronic
909369731 1:74870065-74870087 AAAAGGCCCAAAATACAGCTTGG + Intergenic
909422767 1:75484875-75484897 AAAGGGGCCAAGGAACAGCTTGG - Intronic
909457757 1:75869609-75869631 AAAGTGGCCAACACACAGCTCGG + Intronic
909501290 1:76338009-76338031 AAAAGGTCCAAGATAGAGATAGG - Intronic
909632951 1:77786158-77786180 AAAGGGGCCACCATAGAGCTTGG - Intronic
909718570 1:78739723-78739745 AAAGGGGCCAAGGTATAGCTAGG + Intergenic
909719795 1:78754607-78754629 AAAGGGGCCAAGATACATCTTGG + Intergenic
909757067 1:79239940-79239962 AAAGGGACCAAGGTACAGCTCGG - Intergenic
909808829 1:79905859-79905881 AAAAGGGCCAACACAGAACTTGG - Intergenic
910057662 1:83051161-83051183 AAAGGGGCCAACGTACAGCTTGG - Intergenic
910064897 1:83141224-83141246 AAAGGGGCCAAGGAATAGCTTGG + Intergenic
910103067 1:83599138-83599160 ACAGGGGCCAAGGTACAGCTTGG - Intergenic
910166895 1:84337475-84337497 AAAGGGACCAATGTAGAGCTTGG - Intronic
910215593 1:84840806-84840828 AAAGGAGCCAACATTGTGCCAGG + Intronic
910233234 1:85008150-85008172 AAAGGGGCCAAGAAACAGTTCGG - Intronic
910409411 1:86924661-86924683 AAAAGGGCCAACGTAGAGCTCGG - Intronic
911100594 1:94093017-94093039 TTAGGAGCCAACATAGAGCCAGG + Intronic
911242096 1:95478247-95478269 AAAGGGGTCAAGGTACAGCTTGG + Intergenic
911267693 1:95762415-95762437 AAATGGGCCAAGGTACAGCTTGG - Intergenic
911274974 1:95849775-95849797 AAAGGGGCCAAGGTACAACTCGG + Intergenic
911358485 1:96849101-96849123 AAGGGGGCCAAGGTACAGCTTGG + Intergenic
911465822 1:98251413-98251435 AAAGGGGCCATTGTAGAGATTGG + Intergenic
911517735 1:98888442-98888464 AAAGAGGCGAACACAGAGATGGG - Intergenic
911530387 1:99036877-99036899 AAAGGGGCCAATGTAGAGCTCGG - Intergenic
911541589 1:99163987-99164009 AAAGGGGCCAACGTAGAGCTGGG + Intergenic
911790912 1:102014402-102014424 AAAGAGGCCAAGGTACAGCTTGG + Intergenic
911855734 1:102872551-102872573 AAAGGGGTCAATGTAGAGATTGG - Intergenic
911904341 1:103548002-103548024 AAAAGGGCCAACAAAGAGCTTGG - Intronic
911983379 1:104594006-104594028 AAAGGGCCCAAGGTATAGCTTGG + Intergenic
912042646 1:105411453-105411475 AAAGGGGGCAATGTAGAGTTTGG + Intergenic
912084010 1:105976819-105976841 AAAGGTGCCAAGATACAGCTTGG + Intergenic
912121679 1:106479430-106479452 AAAGGGGCCAAAATAGAGATTGG + Intergenic
912147337 1:106809664-106809686 AAAGGGGCCAAGGTACAGCTGGG - Intergenic
912165656 1:107039785-107039807 AAAGGGGCCAATGTAGAGCTTGG + Intergenic
912192161 1:107352874-107352896 AAAGGGGCCCACCTACAGCTAGG - Intronic
912735914 1:112149467-112149489 AAAGAGGCCAAGGTACAGCTTGG + Intergenic
912890417 1:113524013-113524035 AAAGGGGCCAAGGTACAGCTCGG + Intronic
913396373 1:118376619-118376641 AAAGGGGCCAAGGTACAGCTTGG - Intergenic
913458983 1:119063655-119063677 AAAGGGGCCAAGACAGAGCTCGG + Intronic
914230504 1:145761466-145761488 AAAGGGGCCAACATAGAGCTTGG + Intronic
914857380 1:151362619-151362641 AAAGGGGCCCAGGTATAGCTTGG + Intergenic
914905101 1:151737508-151737530 AAAGGGGCCAAGGTACTGCTTGG + Intergenic
915654868 1:157351050-157351072 AAAGGGACCAATGTAAAGCTTGG - Intergenic
915694158 1:157722100-157722122 AAAGGGCCCCAGATACAGCTTGG - Intergenic
915710956 1:157897360-157897382 AAAGAGGCAAACATAGAGCTTGG - Intronic
916288011 1:163132251-163132273 AAAGGGGCCTAGATACAGCTTGG + Intronic
916318746 1:163479582-163479604 AAAGGGGCCAAAGTAGAGCTTGG + Intergenic
916384830 1:164255613-164255635 AAAGGAGCCAAGGTATAGCTTGG + Intergenic
916411521 1:164551337-164551359 AAAGGGGTCAAGATACAGCTTGG - Intergenic
916467193 1:165084298-165084320 AAAGGGGCCAATATAGAGCTTGG + Intergenic
916477375 1:165183232-165183254 AAAGGGGCCAAGGTACAGCTTGG + Intergenic
916814453 1:168337870-168337892 AAAGGGGACAATGTACAGCTCGG - Intergenic
916829232 1:168474339-168474361 AAAGGGGCCAAAGTGCAGCTTGG + Intergenic
916910528 1:169341242-169341264 AAAGGGGCCAAGATACAGCTTGG + Intronic
917002503 1:170375161-170375183 AAAGGGGCCCAGGTACAGCTTGG - Intergenic
917035465 1:170743175-170743197 AAAGGGACCAAGATAGAGCTTGG - Intergenic
917290827 1:173470906-173470928 AAAGGGGCCAATATACAGCTTGG + Intergenic
917599645 1:176561314-176561336 AAAGTGCCCACCATAGGGCTTGG + Intronic
917894541 1:179474998-179475020 AAAAGGGCCAAGGTACAGCTTGG + Intronic
917894936 1:179478486-179478508 AAAGGGTCCAAGATACAGCTGGG - Intronic
918049209 1:180959691-180959713 AAAGGGGCCAATGTACAGCTTGG - Intergenic
918079472 1:181194777-181194799 AAAGGGGCCTACATAGAGCTTGG + Intergenic
918531174 1:185524200-185524222 AAATGGGCCAAGGTACAGCTTGG - Intergenic
918718159 1:187818235-187818257 AAAGGGGCCAACATAGAGCTTGG - Intergenic
918787048 1:188776084-188776106 AAAGGGGCCAACATTGAGCTTGG + Intergenic
918800160 1:188960939-188960961 AAAGGGGCCAACATAGAGCTTGG + Intergenic
918871243 1:189977643-189977665 AAAGGGGCCAGCATAGAGCTTGG - Intergenic
918931441 1:190860636-190860658 AAAGGGGCCAAGGTCCAGCTTGG - Intergenic
918969650 1:191397701-191397723 AAAGGGGCCAATGTAGAGCTTGG + Intergenic
919156814 1:193776126-193776148 AAAGGGGCCAAGGTACAGCTTGG - Intergenic
919175144 1:194010349-194010371 AAAGTGGCCAATGTAGAGCTCGG + Intergenic
919186979 1:194163621-194163643 GATGGGACCAACATACAGCTGGG + Intergenic
919194339 1:194264120-194264142 AAAGGGGCCAATGTACAGCTTGG + Intergenic
919200397 1:194348821-194348843 AAAGGGGCCAACAGGGAGCCCGG + Intergenic
919209101 1:194455999-194456021 AAATGGGCCAACATACAGCTTGG - Intergenic
919221800 1:194639499-194639521 AAAGGGGCTAACATAGAGCTTGG + Intergenic
919222099 1:194642586-194642608 AAAAGGGCCAACATAGAGCTTGG + Intergenic
919242708 1:194935781-194935803 AAAGCATCCAGCATAGAGCTTGG + Intergenic
919261985 1:195208325-195208347 AAAGGGGCCAAGATACAGCTTGG + Intergenic
919291946 1:195643794-195643816 AAAGGAGCCAAGGTACAGCTTGG - Intergenic
919366611 1:196669530-196669552 AAAGGGGCCAACATACAGCTTGG + Intronic
919371940 1:196739055-196739077 AAAGGGGCCAACAAACAGCTTGG - Intronic
919460576 1:197872164-197872186 AAAGGGGTCAATGTAGAGCTTGG - Intergenic
919883319 1:201915194-201915216 AAAGGAGCTATCAGAGAGCTAGG - Intronic
920594543 1:207255712-207255734 AAAGGAGCCAATGTACAGCTTGG - Intergenic
920783695 1:209020169-209020191 AAAGGGACCAAGATACAGCTAGG + Intergenic
920895987 1:210049796-210049818 AAAGGGGCCACCACAGAGCTCGG - Intronic
921496902 1:215853268-215853290 AAAGGCCCCAATGTAGAGCTTGG - Intronic
921594383 1:217038551-217038573 AAAGGGACCAAGGTACAGCTTGG - Intronic
921716004 1:218417788-218417810 AAAAGGGCCAACATAGAGCTTGG + Intronic
921765950 1:218972949-218972971 AAAGGGGTCAAGGTACAGCTCGG + Intergenic
921773541 1:219071489-219071511 AAAAGGGCCAACATAGAGCTTGG + Intergenic
921792704 1:219308598-219308620 GAAGGCGCCAACGTAGAGCTCGG + Intergenic
922115385 1:222608120-222608142 AAAGGGGCCAGTGTAGAGCTTGG - Intergenic
922164080 1:223100537-223100559 AAAGGGACCAATGTAGAGCTCGG + Intergenic
922530448 1:226341230-226341252 AAAGGGGCCAAGGTACAGCTTGG + Intergenic
923172418 1:231429851-231429873 AAAGAGGACAAGATACAGCTTGG - Intergenic
923198011 1:231686470-231686492 AAAGGGGCCAACATAGAGCTCGG - Intronic
923205324 1:231753399-231753421 AAAGGGGTCCAGATACAGCTTGG - Intronic
923297822 1:232612034-232612056 AAAGGGGTCAGCGTTGAGCTGGG + Intergenic
923339238 1:232993827-232993849 AAAGGGGCCAAAGTACAGCTTGG + Intronic
923461194 1:234211045-234211067 AAAGGGGCCAACATAGAGCTTGG + Intronic
923687357 1:236162640-236162662 AAAGGGGCCAACGTAGAGCTCGG + Intronic
1062770504 10:96598-96620 AAAGGGGCCAAGGTGCAGCTTGG - Intergenic
1062881345 10:980591-980613 AAAGGGGCCCAGTTATAGCTTGG - Intergenic
1063700992 10:8385395-8385417 AAAGGGGCAAGGATAGAGCAGGG + Intergenic
1064084585 10:12335808-12335830 AAAGGGAACAACAGAGAGCAGGG + Intergenic
1064584178 10:16823016-16823038 AAAGGGGCCCAGGTACAGCTTGG + Intergenic
1064626496 10:17266771-17266793 AAAGGGGTCAAAGTACAGCTTGG + Intergenic
1064902709 10:20312114-20312136 AAAGGGGCCAATGTACAGCTTGG - Intergenic
1065347759 10:24765089-24765111 AAAGGGGTCAATGTACAGCTTGG - Intergenic
1065534207 10:26701496-26701518 AAAGGGGCCAAGGTACAGCTTGG + Intronic
1066040783 10:31546389-31546411 AAAGGGGCCAATGTAGAGCTAGG - Intergenic
1066451845 10:35537115-35537137 AAAGGGGCCAAGGCACAGCTCGG + Intronic
1066479978 10:35786272-35786294 AAAAGGGCCAGCATAGAGCTCGG - Intergenic
1066635563 10:37495865-37495887 AAAGGGGCCAACTTATAGCTTGG + Intergenic
1066636820 10:37511447-37511469 AAAAGGGCCAACATAGAGCTTGG + Intergenic
1067206086 10:44215224-44215246 AAAGGGGCCAAGGTACAGCTTGG + Intergenic
1067573274 10:47386977-47386999 AAAGGGGCCAAGGTACAACTTGG - Intergenic
1067911432 10:50350635-50350657 AAAGGGGCCAAAATACAGCCCGG + Intronic
1067956267 10:50795001-50795023 AGAGCGGCCAACATACAACTCGG + Intronic
1068011303 10:51455165-51455187 AAAGAGGCCAAGGTAGAGCTTGG - Intronic
1068285071 10:54923162-54923184 AAAGGGGCCAAAATACAGCCTGG - Intronic
1068289922 10:54989041-54989063 AAAGTGGCCAACATAGAGCTTGG + Intronic
1068400328 10:56519270-56519292 AAAGGGGCCAACATACAGCTTGG - Intergenic
1068416834 10:56734136-56734158 AAAGGGGCCAAAAAAGAGCTTGG - Intergenic
1068431162 10:56934499-56934521 AAATGGGCCAACATATGGCTTGG + Intergenic
1068439421 10:57032228-57032250 AAAGGGGACAATGTAGAGCTTGG + Intergenic
1068519488 10:58062942-58062964 AAAAGGGCCAACGTAGAACTTGG - Intergenic
1068604473 10:58990180-58990202 AAATGGGCCAAGGTACAGCTTGG + Intergenic
1068908361 10:62351909-62351931 AAAGGGGACAACATAGAGCTTGG - Intergenic
1069069999 10:63983258-63983280 AAAGGGGCCAACGTAGAGCTTGG + Intergenic
1069112515 10:64464750-64464772 AAAGGGGGCAAGGTACAGCTTGG - Intergenic
1069173624 10:65262864-65262886 AAAGGGGCCAACATAGAGTTCGG - Intergenic
1069174903 10:65279184-65279206 AAATGGGCCAAGGTATAGCTTGG + Intergenic
1069175762 10:65286509-65286531 AAAGGGGCCAACATAGAGCTCGG - Intergenic
1069211053 10:65760612-65760634 AAAGGGGCCAACATAGAGCTCGG - Intergenic
1069239666 10:66123800-66123822 AAAGGGGCAAATGTCGAGCTTGG - Intronic
1069351346 10:67530913-67530935 AAAGGGGCCAATGTCGAGCTTGG + Intronic
1069798362 10:71067482-71067504 AAAGGAGCCAACTGAAAGCTGGG + Intergenic
1069805180 10:71117891-71117913 AAAGGGGCCAACGTAGAGCTTGG + Intergenic
1069846546 10:71376019-71376041 GAAGGGGCAAAAATAGAGGTGGG + Intergenic
1070651842 10:78243143-78243165 AAAGGGGCCAACGTAGAGCTTGG + Intergenic
1070702730 10:78615337-78615359 AAAGGGCCTTACAGAGAGCTGGG + Intergenic
1070870069 10:79743777-79743799 AAAGGGGCCAAGGTAGAGCTCGG + Intergenic
1071034845 10:81232919-81232941 AAAGGGGCCAATGTACAGCTTGG + Intergenic
1071243841 10:83741064-83741086 AAAGGAGCCAAGGTATAGCTTGG - Intergenic
1071327773 10:84534090-84534112 AAAGGTGCCAAGGTACAGCTCGG + Intergenic
1071442884 10:85718613-85718635 AAAGGGGCCAACACAGAGCTTGG - Intronic
1071550071 10:86560063-86560085 AAAGGGGCTAATGTAGAGCTTGG - Intergenic
1071636991 10:87265997-87266019 AAAGGGGCCAAGGTAGAGCTCGG + Intergenic
1071658253 10:87471957-87471979 AAAGGGGCCAAGGTAGAGCTCGG - Intergenic
1071981041 10:91004505-91004527 AAAGAGGCCAAGGTACAGCTCGG - Intergenic
1072368952 10:94744580-94744602 AAAGGGGCCAAGGTACAGCTTGG + Intronic
1072488036 10:95874877-95874899 AAAGGAGCCAACATAGAGCTTGG - Exonic
1073387027 10:103134375-103134397 AAAGGGGCCAATATAGAGCTCGG + Intronic
1073734223 10:106327207-106327229 AAAGGGGTCAACATAGAGCTCGG - Intergenic
1073817580 10:107224446-107224468 AAAGGGGCCAAGACACAGCTTGG - Intergenic
1073850643 10:107613463-107613485 AAATGGTCTAACACAGAGCTTGG + Intergenic
1073880569 10:107975193-107975215 AAAGGGACCAAGGTACAGCTTGG - Intergenic
1073922940 10:108480486-108480508 AAAGGAGCCAAGGTACAGCTCGG + Intergenic
1073993989 10:109294969-109294991 AAAGGGGCCAACATAGAGCCTGG + Intergenic
1074041433 10:109793421-109793443 AGAGGGGCCAACATGCAGCTTGG - Intergenic
1074262715 10:111870314-111870336 AAAGCGACCAATGTAGAGCTCGG + Intergenic
1074555717 10:114487564-114487586 AAATGTGCCAATGTAGAGCTGGG + Intronic
1074640230 10:115370998-115371020 AAAGGGGCCAAGGTACAGCTTGG + Intronic
1074836789 10:117303745-117303767 AAAGAGGCCAACGTATAGCTTGG + Intronic
1075184775 10:120245826-120245848 AAAGGGACCCAGATACAGCTTGG + Intergenic
1075281674 10:121144080-121144102 AAAGGGGCCAAGGTACAGCTTGG - Intergenic
1076225676 10:128773130-128773152 AATGGAGCCAACATAGAGCTTGG + Intergenic
1076760098 10:132599873-132599895 AAAGGGGCCAACATACAGCTCGG - Intronic
1077740849 11:4843493-4843515 AAAGGAGCCAAGGTACAGCTCGG - Intronic
1077941522 11:6848514-6848536 AAAGGGGCCAAGGTACACCTTGG + Intergenic
1077942572 11:6859149-6859171 AAAGGGGCCAACCTAGAGCTTGG - Intergenic
1077985050 11:7342974-7342996 AAAGGGGTCAAGGTACAGCTTGG - Intronic
1078117377 11:8466953-8466975 AAAGGGCCCAACATAGAGCTCGG - Intronic
1078379723 11:10829278-10829300 AAAGGGTCCAAGGTACAGCTTGG - Intronic
1078496737 11:11824999-11825021 AAAGGGGCCAACATAGAGCTTGG - Intergenic
1078517970 11:12040759-12040781 AAAGGGGCCAACATAGAGCTTGG - Intergenic
1078543520 11:12229793-12229815 AAAGGGGCCAGAATTGGGCTGGG - Intronic
1078687411 11:13546383-13546405 ACAGGGGCCAAGGTACAGCTTGG + Intergenic
1078712963 11:13813035-13813057 AAAGGGGCCAATGTAGAGCTTGG - Intergenic
1078988171 11:16614437-16614459 AAATGGGCGACTATAGAGCTGGG - Intronic
1079143829 11:17833229-17833251 AAAGGGGCCAACGTAGAGCTTGG + Intronic
1079341062 11:19612119-19612141 AAAGGGGCCAATGTAGAGCTTGG - Intronic
1079469058 11:20760868-20760890 AAAGGGGCCAAGTGAGACCTGGG - Intronic
1079559441 11:21803980-21804002 AAAGAGGCCAACATACAGCTTGG - Intergenic
1079654982 11:22975881-22975903 AAAGTGGCCAAGGTAGAGTTTGG + Intergenic
1079673660 11:23199108-23199130 ACAGGGGCCAATGTAGAGCCTGG - Intergenic
1079707396 11:23637788-23637810 AAAGGAGCCAAGATACAGCTTGG - Intergenic
1079739185 11:24036257-24036279 GAAAGGGCCAATATAGAGCTTGG + Intergenic
1079744397 11:24106826-24106848 AAAGGGGCCAAGGTACAGCTTGG + Intergenic
1079759412 11:24310284-24310306 AAAGGGGTCAAGGTACAGCTTGG + Intergenic
1079798928 11:24844754-24844776 AAAGAGGCCAACATAGAACTCGG + Intronic
1079838673 11:25366975-25366997 AAAGGGGCCAAGGTACAGTTGGG - Intergenic
1079856408 11:25610634-25610656 AAAAGGGCCAATGTACAGCTTGG - Intergenic
1079880587 11:25922041-25922063 TAAGGGGCCAACATAGAGCTTGG - Intergenic
1079886847 11:26000941-26000963 AAAGGGGCCAAGATACAGCTTGG - Intergenic
1079962457 11:26941091-26941113 AAAGGCATTAACATAGAGCTTGG - Intergenic
1080065098 11:28002162-28002184 AAAGGGGCCAAGAAACAGCTTGG + Intergenic
1080151439 11:29056770-29056792 AAAGGGGCCAGTGTAGATCTTGG + Intergenic
1080183008 11:29446384-29446406 AAAGGGGCCAGTGTAAAGCTTGG + Intergenic
1080215179 11:29832053-29832075 AAAGTGGCCAAGATACAACTTGG + Intergenic
1080739300 11:35049018-35049040 AAAAGGGGCAACATAGAGCTTGG + Intergenic
1080817424 11:35772066-35772088 AAAGGGGCCAACGTAGAGCTCGG + Intronic
1080966244 11:37217846-37217868 AAAGGGGCCAAGGTATAGGTTGG - Intergenic
1080982400 11:37424092-37424114 AAAGGGGCCAAGGTACAGCTTGG - Intergenic
1081008161 11:37774126-37774148 AAAGGGGCCAACATAGAGCTTGG - Intergenic
1081108304 11:39100316-39100338 AAAGGGACCAACGTAGAGCTTGG - Intergenic
1081175444 11:39922070-39922092 AAAGGGGTCAACGTACAGCTTGG + Intergenic
1081238893 11:40679594-40679616 AAAGGGGCCAAGGTACAGCTTGG + Intronic
1081246350 11:40771287-40771309 AAATGGGCCAAAGTACAGCTTGG - Intronic
1081278867 11:41183982-41184004 AAAGGGGCCAAGTTATAGCTTGG - Intronic
1081316564 11:41637671-41637693 AAATGGGCCAAGGTACAGCTTGG - Intergenic
1081444450 11:43116981-43117003 AAAGGGGCCAGAATATAGCTGGG - Intergenic
1081479925 11:43476628-43476650 AAAGAGGCCAACATACAGCTTGG - Intronic
1081769016 11:45635810-45635832 AAAGGAGCCAAAGTACAGCTCGG + Intergenic
1081939420 11:46928220-46928242 AAAGGGGCTAACATAGAGCTTGG + Intergenic
1082652100 11:55806350-55806372 AAAGGGGGCAAGGTACAGCTTGG - Intergenic
1082766198 11:57169821-57169843 AAAGGGGCCAAGGTAGAGCTTGG - Intergenic
1082948009 11:58780657-58780679 AAAGGGGCCAATGTACAACTCGG - Intergenic
1083121891 11:60521057-60521079 AAAGGGGCCAATGTAGAGCTTGG - Intronic
1083136121 11:60678305-60678327 AAAGGGGCCAAGGTACAGCTTGG - Intergenic
1084841687 11:71856561-71856583 AATGGGGCCGAAATAGAGTTAGG + Intergenic
1085236479 11:75019454-75019476 AAAGGGGCCAATGTAGAGCTTGG + Intergenic
1085593977 11:77791274-77791296 AAAGGGGCCAAGTTACAGCTTGG - Intronic
1085651517 11:78272911-78272933 AAAGGGGCCAAGGTACAGCTTGG + Intronic
1085941844 11:81214218-81214240 AAAGGGGCCAAGGTACAGCTCGG - Intergenic
1085986313 11:81792486-81792508 CAATGGGCTAACATACAGCTTGG - Intergenic
1086173221 11:83859911-83859933 AAAGGGGCCAAGGTAGAGCTTGG + Intronic
1086176749 11:83900525-83900547 AAAGAGGCCAACATAGAGCTTGG + Intronic
1086519256 11:87651120-87651142 AAAGGGGCCAATGTACAGCTCGG - Intergenic
1086580376 11:88391960-88391982 AAAGGGGCCAATGTAGAGCTCGG - Intergenic
1086604982 11:88685710-88685732 AAAGTGGCCAAGGTATAGCTTGG + Intronic
1086764313 11:90675765-90675787 AAAGGGGCCAATGTAGAGCTTGG + Intergenic
1086769532 11:90744908-90744930 AAAGGGGCCAAGGTATAGCTTGG + Intergenic
1086995752 11:93353741-93353763 AAAGGGGCCAATGTAGAGCTTGG - Intronic
1087255574 11:95948806-95948828 AAAGGGGCCAACATAGAGCTTGG - Intergenic
1087336575 11:96851793-96851815 AAAGGGGCCAAGATACAGCTTGG + Intergenic
1087385495 11:97463920-97463942 AAAAGGGCCAAGGTACAGCTTGG + Intergenic
1087393637 11:97569822-97569844 AAAAGGGCCAAGGTATAGCTTGG - Intergenic
1087474337 11:98618129-98618151 AAAGGGGCCAACATAAAACTTGG - Intergenic
1087474604 11:98620340-98620362 AAAGGGGCCAATGTAGAGCTTGG + Intergenic
1087496301 11:98894344-98894366 AAAGGGGCCAATGTAGAGCTTGG - Intergenic
1087497319 11:98907951-98907973 AAAGGGGCCTACCTAGAGCTTGG + Intergenic
1087517470 11:99181782-99181804 AAAGGGGGCAACTTAAATCTTGG - Intronic
1087668950 11:101083133-101083155 AAAGGGGCCAAGGTACAGCTTGG + Intronic
1088014014 11:105037532-105037554 AAAGGGGCCAAGAAATAGCTTGG + Intergenic
1088426968 11:109714866-109714888 AAAGAGGCCAAAATAGAGCTTGG - Intergenic
1088435250 11:109805017-109805039 AAAGGGGCCAATATAGAGCTTGG - Intergenic
1088497061 11:110441986-110442008 AAAGGGGCCAATGTAGAGCTAGG + Intronic
1089284812 11:117398702-117398724 AAAGGGGGCAAGGTACAGCTTGG - Intronic
1089837987 11:121388453-121388475 AAAGGGGGCAACATAGGGAAAGG + Intergenic
1090302059 11:125651060-125651082 AAAAGGTCCAACATATACCTGGG - Intronic
1090316743 11:125797725-125797747 AAAGGGGACAAGTTACAGCTCGG - Intergenic
1090556881 11:127885602-127885624 AAAAGGGCCAAGATACAGCTCGG - Intergenic
1090573017 11:128068345-128068367 AAATGGCCCAATGTAGAGCTTGG - Intergenic
1090692570 11:129199476-129199498 AAAGGGGCCAAGATACAGTTTGG + Intronic
1090727396 11:129540124-129540146 AAAGGGGCCAACGTAGAGCTCGG - Intergenic
1090872915 11:130763665-130763687 TAATGTGCCAACATAGAACTGGG + Intergenic
1091086350 11:132725310-132725332 AAAGGGGCCAATGTAGAGTTTGG - Intronic
1091932078 12:4404144-4404166 AAAGGATCCAACATAGAGCTTGG + Intergenic
1092459114 12:8670970-8670992 AAAGGGGCCAACATACAGCTTGG - Intergenic
1092652205 12:10646839-10646861 AAAAGGGCCAAGGTACAGCTTGG + Intronic
1092662684 12:10755643-10755665 AAAGGGGCCATGGTACAGCTCGG - Intergenic
1092944327 12:13438987-13439009 AAAGGGGCCAACATACAGCTTGG - Intergenic
1093014805 12:14145055-14145077 AAAGGGGCCAAAGAACAGCTTGG - Intergenic
1093041497 12:14385478-14385500 AGAGGGGTGAACTTAGAGCTTGG + Intronic
1093192593 12:16092088-16092110 AAAGGGGCCAAGGTACAGCTCGG - Intergenic
1093300060 12:17442884-17442906 AAAGGGGCCAACATAGAGCTTGG + Intergenic
1093353099 12:18128127-18128149 AAAGGGGCCAACATAGAACTTGG + Intronic
1093380394 12:18484215-18484237 AAAGGAGAAAACATGGAGCTGGG + Intronic
1093519907 12:20036726-20036748 AAAGGGGCCACCACAGAGCTGGG - Intergenic
1093570508 12:20661610-20661632 AAAGAGGCCAAGGTACAGCTTGG + Intronic
1093585818 12:20835111-20835133 AAAGGGGCCAAGGTACAGCTTGG - Intronic
1093590459 12:20895998-20896020 AAAGGGACCAATGTAGAGCTTGG - Intronic
1093681458 12:22008123-22008145 AAAGGGGCCAAGATACAGCTTGG + Intergenic
1093992986 12:25610703-25610725 AAAGGAGACAACATGGGGCTTGG + Intronic
1094251740 12:28369845-28369867 AAAAGGGCCAAGGTACAGCTCGG - Intronic
1094397626 12:30025076-30025098 AAAGGGGCCAAGGTACAGCTTGG - Intergenic
1094489272 12:30948556-30948578 AAAGGGGCCAACATAAAGCTCGG - Intronic
1094706050 12:32915439-32915461 AAAGGGACCAACGTAGAGCTTGG + Intergenic
1094716173 12:33017315-33017337 AAAGGGGCCAAGATACAGCTTGG + Intergenic
1094798491 12:34002594-34002616 AAAGGGGCCAAGGTACAGTTTGG - Intergenic
1095111251 12:38296681-38296703 AAAGGGGCCAAGGTACAGTTTGG - Intergenic
1095122639 12:38437391-38437413 AAAGGGGACAAGGTACAGCTTGG - Intergenic
1095252603 12:39996660-39996682 GAAGGGGCCAACATAGAGTTCGG + Intronic
1095300848 12:40582022-40582044 AAAGGGGCCAAGTTATAGCTGGG - Intergenic
1095731569 12:45511667-45511689 AAAGGGGCCAAGGTACAGCTGGG - Intergenic
1095765191 12:45886777-45886799 AAAAGGGCCAAGGTACAGCTTGG - Intronic
1095928833 12:47605986-47606008 AAAGGGGCCAACTTAGAGCTTGG - Intergenic
1096063337 12:48720243-48720265 AAAGTGGCCAACACAGAGCTTGG - Intergenic
1096441807 12:51649613-51649635 AGAGGGGCCAATGTAGAGCTCGG - Intronic
1096875560 12:54627581-54627603 AAAGGGGCCAACATAGAGCTTGG + Intergenic
1097329621 12:58318780-58318802 AAAGGGGCCAACATAGAGCTCGG - Intergenic
1097401652 12:59134910-59134932 AAAGGGGCCAAGGTACAACTTGG - Intergenic
1097411000 12:59253021-59253043 AAAGAGGCCAAAGTACAGCTTGG + Intergenic
1097498926 12:60378023-60378045 AAAGGGGACAAAATACAGCTTGG + Intergenic
1097668841 12:62512959-62512981 AAAGGGGTCAACATAGAGCTCGG - Intronic
1098238652 12:68443165-68443187 AAAGGGGCTAACATATAGCTTGG - Intergenic
1098614642 12:72507930-72507952 AAAGGGGCCAAGGTATAGCTTGG + Intronic
1098630904 12:72720638-72720660 AAAGGGGCCAAGGTACAGCTTGG + Intergenic
1098774877 12:74600218-74600240 AAAGGGGCCAAGGTACAGCTTGG + Intergenic
1098837702 12:75441894-75441916 AAAGGGGCCAAGGTACAGCTGGG + Intergenic
1098865693 12:75760779-75760801 AAAGGGGCCAAAATATACATAGG + Intergenic
1098939559 12:76518755-76518777 AAAGGGGCCCAGGTACAGCTTGG - Intronic
1099088617 12:78278233-78278255 AAAGGGGTCAAGGTACAGCTTGG + Intergenic
1099371350 12:81835033-81835055 AAAGGGGTCAAAGTACAGCTTGG + Intergenic
1099379705 12:81938957-81938979 AAAGGGGCCAGTGAAGAGCTTGG - Intergenic
1099384427 12:81997556-81997578 AAAGGGGCCAAGGTACAGCTCGG - Intergenic
1099386431 12:82018768-82018790 AAAGGGGCCCAAGTACAGCTTGG + Intergenic
1099407883 12:82285280-82285302 AAAGGGGCCAACATAGAGCTTGG + Intronic
1099501442 12:83418928-83418950 AAAAGGACCAATGTAGAGCTTGG + Intergenic
1099507747 12:83500171-83500193 AAAGGGGACAATGTGGAGCTTGG + Intergenic
1099655094 12:85479346-85479368 TAAGGGGCCAATGTAGAGCTTGG - Intergenic
1099694296 12:85998162-85998184 AAAGGGACCAACATAGAGCTTGG - Intronic
1099700419 12:86075771-86075793 AAAGGGGGCAACACAGAGCTTGG - Intronic
1099707849 12:86180112-86180134 AAAGGGGCCAATGTAGAGCTTGG + Intronic
1099722542 12:86382735-86382757 AAAGGGGCAGACATAGAGCTTGG + Intronic
1099800553 12:87451671-87451693 AAAGGGGCCAAAGTAGAGCTTGG + Intergenic
1099802459 12:87474311-87474333 AAAGGGGCCAAAGTAGAGCTTGG + Intergenic
1099858921 12:88204963-88204985 AAAGGGACCAAGGTACAGCTCGG + Intergenic
1100159656 12:91843551-91843573 AAAGGGGCCAAGGAACAGCTTGG + Intergenic
1100230346 12:92600412-92600434 AAAAGGGCCAAGGTACAGCTTGG - Intergenic
1100348348 12:93754172-93754194 AAAAGGGCCAAGGTAGAGCTTGG - Intronic
1100678441 12:96893381-96893403 AAAGGTGCCAACATACAGCTTGG + Intergenic
1100787656 12:98095919-98095941 AAAGGGGCCAAGGTACAGCTTGG + Intergenic
1100933638 12:99638880-99638902 AAAGGTGCCAAGGTACAGCTCGG + Intronic
1100937924 12:99691095-99691117 AAAGGGGCAAAGGTACAGCTTGG - Intronic
1100971927 12:100079884-100079906 AAAGGGGCCAACACAGAGCTTGG + Intronic
1101083750 12:101214653-101214675 GAAGGGGCCAAGGTACAGCTTGG + Intergenic
1101113245 12:101506698-101506720 AAAAGAGCCAACATAGAGCTTGG + Intergenic
1101187022 12:102290779-102290801 AAAGGGGCCAATGTAGAGTTTGG + Intergenic
1101194658 12:102370009-102370031 AAAGGGACCAAGGTACAGCTTGG - Intergenic
1101222784 12:102658157-102658179 AAAGGGGCCAGCATAGAGCTTGG - Intergenic
1101340313 12:103837188-103837210 GAAGAGGCCAATGTAGAGCTTGG - Intronic
1101478771 12:105076809-105076831 AAAGGGCTCAACATAGTGTTTGG - Intronic
1101526410 12:105535159-105535181 AAAGTGGCCAAGGTACAGCTCGG - Intergenic
1102027109 12:109719880-109719902 TTAGAGGCCAACAGAGAGCTTGG + Intronic
1102211741 12:111132223-111132245 AAAGGGGCCAGTGTACAGCTCGG - Intronic
1102528648 12:113530250-113530272 AAAGAGGCCAACATAGAGCTCGG + Intergenic
1103263485 12:119609633-119609655 AAAGGGGACAAAGTATAGCTTGG + Intronic
1103264569 12:119618096-119618118 AAAGGAGCCAAGGTACAGCTTGG + Intronic
1103358167 12:120337096-120337118 AAAGGAGCCAAGGTACAGCTCGG - Intergenic
1104210505 12:126684059-126684081 AAAAGGGCCAAGGTACAGCTTGG - Intergenic
1104547609 12:129726342-129726364 AAAGGGACCCAGATAAAGCTAGG + Intronic
1105650549 13:22372364-22372386 AAAGAGGCCAAGGTACAGCTTGG - Intergenic
1105657511 13:22456858-22456880 AAAGGGGCCAAGGTACAGCTTGG - Intergenic
1106048165 13:26165161-26165183 AAAGGGGCCAACGTAGAACTTGG + Intronic
1106614437 13:31313956-31313978 AAAGAGGCCAAAGTACAGCTTGG + Intronic
1106614709 13:31315895-31315917 AAAGGGGCCAAGGTACAGCTTGG + Intronic
1106678293 13:31984632-31984654 AAAGGTGCCAAGGTACAGCTCGG + Intergenic
1106917334 13:34529634-34529656 AAAGGGGCCAACATACAGCTCGG + Intergenic
1107961922 13:45566535-45566557 AAAGGGGCCAACATAGAGCTTGG + Intronic
1108175759 13:47791042-47791064 AATGGGGCCAACTTAGAGCTTGG + Intergenic
1108419459 13:50233823-50233845 AAAAAGGCCAACACAGAGCTCGG + Intronic
1108724328 13:53163727-53163749 GAAAGGGCCAATGTAGAGCTTGG - Intergenic
1108768374 13:53663443-53663465 AAAGGGGCCAATGTAGAGTTGGG + Intergenic
1108790664 13:53966221-53966243 AAAGGAGCCAACATACAGCTTGG + Intergenic
1108883966 13:55156606-55156628 AAAGGGGCTAATGTACAGCTTGG + Intergenic
1108936806 13:55891580-55891602 AAAGGGGCCAAGGTACAGCTCGG - Intergenic
1109098224 13:58144794-58144816 AAAGGGGCCAATGGAGAGCTCGG + Intergenic
1109221703 13:59646829-59646851 AAAGGGGCCAACGTACAGTTTGG + Intergenic
1109285998 13:60409054-60409076 AAAGGGGCCAACATATAGCTTGG + Intronic
1109294464 13:60513185-60513207 AAAGGGACCAATGTAGAGCTGGG - Intronic
1109297535 13:60552841-60552863 AAAGGGGCCAAGATGCAACTTGG - Intronic
1109334875 13:60981313-60981335 AAAGGGGCCAAGGTACAGCTTGG - Intergenic
1109482474 13:62973954-62973976 AAAGGGGCCAACTTACAGCTCGG - Intergenic
1109616196 13:64837074-64837096 AAAGGGGCCAAGATACAGCTGGG + Intergenic
1109641948 13:65202778-65202800 AAATGGGTCAAGATACAGCTAGG + Intergenic
1109681285 13:65756356-65756378 AAAAGGGCCAAGGTACAGCTTGG + Intergenic
1109697325 13:65977782-65977804 AAAGGGGCCAATGTAAAGTTTGG + Intergenic
1109702748 13:66048102-66048124 AAAGGGGCCGATGTAGAGCTCGG - Intergenic
1109810693 13:67509299-67509321 AAAGGGGCCAATGTAGAGCTTGG + Intergenic
1109871862 13:68342874-68342896 AAAGGGGCCAAGGTACAGTTCGG - Intergenic
1109883482 13:68512061-68512083 AAAGGGGCCAAAATAGAGCTTGG + Intergenic
1110007732 13:70293773-70293795 AAACGGGCCAAGGTACAGCTAGG + Intergenic
1110038397 13:70718096-70718118 AAAGGGGCCAAGGTACAGCTCGG + Intergenic
1110083400 13:71345896-71345918 AAAGGGGCTAATGTAGAGCTTGG - Intergenic
1110208646 13:72947263-72947285 GAAGGGGCCAATGTACAGCTCGG - Intronic
1110377843 13:74814434-74814456 AAAGAGGCCAACCTAGAGATTGG + Intergenic
1110487888 13:76068133-76068155 AAAGGGGCCAAGCTAAAGCTCGG + Intergenic
1110511425 13:76355758-76355780 AAAGGGGCCAAGGTATAGCTTGG + Intergenic
1110806151 13:79756699-79756721 AAAGGGGCCAATGTAGAGCACGG - Intergenic
1110892946 13:80713017-80713039 AAAGGGGCCAAGGTACAGCTTGG - Intergenic
1110902257 13:80837712-80837734 AAAGGGGCCAAAGTAGGGCTGGG - Intergenic
1111029393 13:82575468-82575490 AAAGGGGCAAACACAGAGCTAGG - Intergenic
1111045887 13:82812702-82812724 AAAGGGGCCATCATAGAGCTTGG + Intergenic
1111050887 13:82882425-82882447 AAAGGGGCCAAAGTACAGCTTGG + Intergenic
1111051204 13:82884655-82884677 AAAGGGGCCCAAGTACAGCTTGG - Intergenic
1111083102 13:83337835-83337857 AAAGGGCCCAACATGAAGCTCGG + Intergenic
1111143814 13:84155841-84155863 AAAGGGCCCAACATAGAGCTTGG + Intergenic
1111154909 13:84309679-84309701 AAAGGGGCCAAGGTACAGCTCGG + Intergenic
1111207779 13:85035208-85035230 AAAGGGGCCTAGTTACAGCTTGG + Intergenic
1111227128 13:85288731-85288753 AAAGGGACCAAGGTACAGCTTGG - Intergenic
1111334233 13:86800544-86800566 AAAGGGTCCAGTGTAGAGCTTGG + Intergenic
1111463436 13:88576162-88576184 AAAGGGCCCCAGATATAGCTTGG - Intergenic
1111474110 13:88724333-88724355 AGAGGGGCCAATATAGAGCTTGG + Intergenic
1111527630 13:89492580-89492602 AAAGGGGCCAAGGTACAGCTCGG - Intergenic
1111544537 13:89714134-89714156 AAAGTGGCCATCCTAGAGATTGG - Intergenic
1111614335 13:90644088-90644110 AAAGGGGCCAATGTACAGCTTGG - Intergenic
1111621580 13:90731844-90731866 AAACGGACCAACCTAGAGGTCGG + Intergenic
1111687246 13:91516913-91516935 AAAGGGGACAACGTACAGCTCGG - Intronic
1111769982 13:92584830-92584852 AAAGGGGCCAACGTACAGCTTGG + Intronic
1112120254 13:96402132-96402154 AAAGAGGCCTAAATAGAACTGGG - Intronic
1112160102 13:96858283-96858305 AAAGAAGCCAACACAGTGCTAGG + Intergenic
1112512229 13:100020142-100020164 AAAGAGGCCAAGGTACAGCTCGG + Intergenic
1112742975 13:102495698-102495720 AAAGGGGCCAAGGTATAGCTTGG - Intergenic
1112744191 13:102508697-102508719 AAAGGGGCCAAGGTACAGCTTGG + Intergenic
1112840042 13:103564490-103564512 AAAGGGTCCAAGGTATAGCTTGG - Intergenic
1112881306 13:104109411-104109433 AAAAGGGCCAAGATACAGCTTGG + Intergenic
1112953797 13:105034964-105034986 TAAGGGGCAAAAATAGAGCTTGG - Intergenic
1113087756 13:106585717-106585739 AAAGAGGCCAAGGTACAGCTTGG + Intergenic
1113269269 13:108655289-108655311 AAAGGGGCCAAGGTCCAGCTGGG + Intronic
1113280509 13:108782760-108782782 AATGGGGCCAATGTAGAGCTTGG + Intronic
1113284912 13:108836198-108836220 AAAGGGGCCAAAGTATAGCTTGG + Intronic
1113497554 13:110743795-110743817 AAAGGGGACAATGTACAGCTTGG - Intergenic
1113501891 13:110782270-110782292 AAAGGGGCCAAGATACAGCTTGG - Intergenic
1113645281 13:111990645-111990667 AAAAGGGCCAAGGTACAGCTTGG + Intergenic
1114217165 14:20665551-20665573 AAAGGGGCTAACATACAGCTTGG - Intergenic
1114948392 14:27715841-27715863 AAAGGGGCCAAAGTACAGTTTGG + Intergenic
1114986119 14:28230843-28230865 AAAGGGGCCAACATAGAGCTGGG - Intergenic
1114986726 14:28238851-28238873 AAAGGGGCTAAGGTACAGCTTGG + Intergenic
1115051873 14:29072716-29072738 AAAGAGGCCAAGGTATAGCTTGG - Intergenic
1115113657 14:29854851-29854873 AAAGGGGCCAACAGGGAGCTTGG + Intronic
1115134780 14:30095572-30095594 AAAGGGGCCAAGGTACAGCTTGG + Intronic
1115199137 14:30834484-30834506 AAAGGGACCAAGGTACAGCTTGG - Intergenic
1115878764 14:37891791-37891813 AAAGAGGCCAAGGTACAGCTTGG + Intronic
1115968226 14:38915934-38915956 AAAGGGGCCATGGTACAGCTTGG - Intergenic
1116080238 14:40162408-40162430 AAAGGGGCCAAGTTTCAGCTCGG + Intergenic
1116120508 14:40717360-40717382 AAATGGACGAAAATAGAGCTTGG + Intergenic
1116164152 14:41311825-41311847 AAAGTGGCCAACGTACAGCTTGG + Intergenic
1116265735 14:42687490-42687512 AAAGGAGCCAAGTTACAGCTTGG - Intergenic
1116281565 14:42914929-42914951 AAAGGGGCCAATGTAGAGCTTGG - Intergenic
1116303538 14:43217674-43217696 AATGGGCCCAATGTAGAGCTTGG - Intergenic
1116387371 14:44348215-44348237 AAAGGGGCCAATGTAGAGCTTGG + Intergenic
1116393690 14:44422886-44422908 AAAGGGGGCAAGGTACAGCTCGG - Intergenic
1116420069 14:44722315-44722337 AAAGGGACCAAGGTACAGCTTGG + Intergenic
1116564912 14:46432578-46432600 AAAAGGGCCAAGGTACAGCTTGG - Intergenic
1116642719 14:47485732-47485754 AAAGGGGACAATGCAGAGCTTGG + Intronic
1116696386 14:48183250-48183272 AAAGGGGACAAGGTATAGCTAGG + Intergenic
1116707245 14:48317668-48317690 AAAGGGGCCATCTTAAAGCTAGG - Intergenic
1116762082 14:49027003-49027025 TAAGGGGTGAACGTAGAGCTCGG + Intergenic
1116917239 14:50537196-50537218 AAAGGGGCCAACATAGAGCTGGG + Intronic
1116931363 14:50694359-50694381 AAAGTGGTCAATGTAGAGCTTGG - Intergenic
1116986262 14:51223146-51223168 AAATGAGCCAACATGGAGCTTGG - Intergenic
1117084124 14:52181431-52181453 AAAGGGGCCAAGGTACAGCTGGG - Intergenic
1117181942 14:53200382-53200404 GAAGGGGCCAACATACAACTTGG + Intergenic
1117198518 14:53364369-53364391 AAAGGGGCCAACATACAGCTTGG - Intergenic
1117525934 14:56604317-56604339 AAGGGGGCCAGTGTAGAGCTTGG - Intronic
1117529734 14:56648504-56648526 ACAGGGGCCTATATAGTGCTTGG - Exonic
1117751691 14:58930268-58930290 AAAGGAGCCAATGTAGAGTTCGG - Intergenic
1117984572 14:61374641-61374663 AAAGGGGCCAATGTACAGCTCGG - Intronic
1118092508 14:62497843-62497865 AAAGGGGCCAATGGACAGCTTGG - Intergenic
1118532980 14:66728061-66728083 ACAGGGGCCAAGGTAAAGCTTGG + Intronic
1118533407 14:66731908-66731930 AAAGGGGCCAAGGTACAGTTTGG + Intronic
1118835980 14:69478187-69478209 AAAGGGGACAACGTAGAGCTTGG - Intergenic
1118933436 14:70264138-70264160 AAAGGGACCAACGTACAGCTCGG + Intergenic
1118963890 14:70561709-70561731 AAAGGGGCCAAAGTACAGCTCGG + Intergenic
1119142947 14:72284428-72284450 AAAGGGGCCAAGGTATAGCTGGG + Intronic
1119150831 14:72358020-72358042 AAAGGGGTCAAGGTACAGCTCGG + Intronic
1119216368 14:72872118-72872140 AAAGGGGCCAACATATAGCTCGG - Intronic
1119444785 14:74654127-74654149 GAAGGGGCCAAGATAGTGGTTGG - Intronic
1119450159 14:74702426-74702448 AAAGGAGCCAAGGTACAGCTTGG - Intronic
1120247932 14:82027835-82027857 AAAGGGGCTAATGTAGAGCTTGG - Intergenic
1120457763 14:84754427-84754449 AAAGGGGCCAAGGTACAGCTTGG + Intergenic
1120621912 14:86775220-86775242 AAAGGGGCCAACGAAGAGCTTGG + Intergenic
1120688227 14:87563514-87563536 AAAAGGGGCAACATACAGCTCGG + Intergenic
1120707374 14:87758744-87758766 AAGGGTGCCAGCAGAGAGCTAGG - Intergenic
1120799797 14:88675428-88675450 AAAGGGGCCAAAGTACAGCTTGG - Intronic
1121166499 14:91807001-91807023 AAAGGGGCCAAGGTACAGCTTGG + Intronic
1121881876 14:97508100-97508122 AAAGGGGCCAATGTAGAGCTTGG + Intergenic
1122379961 14:101295784-101295806 AAAGGGGCCAAGGTACAGCTTGG - Intergenic
1124062356 15:26306093-26306115 AAAGGGGCCAAAGTGCAGCTTGG + Intergenic
1124066274 15:26347040-26347062 AAAGGGGCCAACATACAGCTTGG + Intergenic
1124171379 15:27376628-27376650 AAAGGGGCCAACATAAAGTTCGG - Intronic
1124226241 15:27897438-27897460 AAAGGAGCCAAGGCAGAGCTCGG + Intronic
1125279255 15:38026816-38026838 AAAGGGGCCAACATAGAGCTCGG + Intergenic
1125806610 15:42498455-42498477 AAAGGGGTCAAGGTACAGCTTGG - Intronic
1125881368 15:43198864-43198886 AAAGGGGCCAACATACCGCTTGG + Intronic
1126062047 15:44792175-44792197 AAAGGGGTCAACACAAATCTGGG + Intergenic
1126185098 15:45823866-45823888 AAAGGGCCCAAGGTACAGCTCGG - Intergenic
1126399837 15:48257624-48257646 AAAGGGGCCAAGGTATAGCTTGG - Intronic
1126929501 15:53632250-53632272 AAAGGGGCCAAGATATAGCTTGG + Intronic
1127145020 15:56014779-56014801 AAAGGGGCCAACACAGAGCTTGG - Intergenic
1127955185 15:63847133-63847155 AAAGGGGGCAGGATACAGCTCGG + Intergenic
1127965742 15:63921633-63921655 AAAAGGGCAAACATAAAGATGGG - Intronic
1128119792 15:65137180-65137202 AAAGGGGCCAAGGTACAGCTTGG - Intergenic
1128573756 15:68755261-68755283 AGAGGGGCAAACATGGATCTTGG - Intergenic
1129524435 15:76204865-76204887 AAAGGGATCAACCTAGAGGTGGG + Exonic
1129549204 15:76430025-76430047 AAAGGGGCCAAGATACAGCTTGG + Intronic
1129845525 15:78766183-78766205 AAAGGGGGCAGCGTGGAGCTGGG + Exonic
1129901065 15:79149820-79149842 AAAGGAGCCAAGGTACAGCTTGG - Intergenic
1130416896 15:83702569-83702591 AAAGGGGCCAATGTAGAGCTCGG + Intronic
1130738948 15:86577731-86577753 AAAGGGGCCAACATAGAGCTCGG + Intronic
1130778392 15:87009268-87009290 AAAGGGGCCAATGTACAGCTCGG + Intronic
1131198871 15:90379613-90379635 AAAGGGGCCCAAGTACAGCTTGG - Intergenic
1131556480 15:93404192-93404214 AAAGGGGCCAACGTACAGCTTGG + Intergenic
1131659502 15:94498821-94498843 AAAGGGGCCAAGGTACAGCTTGG + Intergenic
1131723808 15:95201403-95201425 AAAGGGGGCAAGGTACAGCTCGG + Intergenic
1131743663 15:95421494-95421516 GAAAGGGCCAAAATAGAGCTCGG - Intergenic
1131767936 15:95700773-95700795 AAGGGGGCCAGCATAGAGCTTGG - Intergenic
1131987596 15:98060707-98060729 AAAGGGGTCAAGGTAGAGCTTGG - Intergenic
1132122786 15:99192453-99192475 AAAGGGGCCATCATAGAGCTTGG + Intronic
1132194116 15:99897342-99897364 AAAAGGGCCAAAGTACAGCTTGG - Intergenic
1132388158 15:101416723-101416745 AAAGGAGCCAACGTACAGCTTGG + Intronic
1134331988 16:13259716-13259738 AATGGGGCCAACATACGGCTTGG - Intergenic
1134660608 16:15981531-15981553 AAAGGGGCCAAAATGCTGCTCGG - Intronic
1135307697 16:21381089-21381111 AAAGGAGGCAACAAAGAACTTGG - Intergenic
1135358676 16:21792369-21792391 AAAGGGGGCAAGATAGAGGGAGG + Intergenic
1135457232 16:22608805-22608827 AAAGGGGGCAAGATAGAGGGAGG + Intergenic
1136304441 16:29360210-29360232 AAAGGAGGCAACAAAGAACTTGG - Intergenic
1137769513 16:51004723-51004745 AAGGGGGCAAGCATGGAGCTGGG - Intergenic
1137818591 16:51422396-51422418 AAAGGAGCCAAGGTACAGCTCGG - Intergenic
1137951911 16:52791848-52791870 AAAGGGGACAAGGTACAGCTTGG + Intergenic
1137981577 16:53074615-53074637 AAAGGGGTCAATGTAGAGCTTGG + Intronic
1138003845 16:53311443-53311465 AAAGTGGCCAATAAAGAGCTTGG + Intronic
1138772897 16:59686515-59686537 AAAGGGGCCAAGTTACAGCTTGG - Intergenic
1138859994 16:60744390-60744412 AAAAGGGCCAACGCAGAGCTTGG - Intergenic
1139166059 16:64566531-64566553 AAAGGGGCCAATATATAGCTTGG + Intergenic
1139472552 16:67185964-67185986 AAAGTGGCCACCATAGTGCCTGG - Intronic
1139751344 16:69110578-69110600 AAAAGGGCTAACATGGAGCTGGG - Intronic
1141037831 16:80643710-80643732 AAAGGGGCCAACATACAGCTTGG - Intronic
1141163835 16:81647459-81647481 AAAGGGGCTGACTTAGAGCAGGG - Intronic
1143455990 17:7068130-7068152 AAAGGGGCCCAGGTACAGCTTGG - Intergenic
1143721213 17:8811195-8811217 AAAGGGACCAATGTAGAGCTCGG - Intronic
1144448258 17:15352032-15352054 AGAGGGGCCACCTTTGAGCTGGG - Intergenic
1144508759 17:15857127-15857149 GAAGGGGCCAATGTACAGCTTGG + Intergenic
1144538538 17:16115153-16115175 AAAGGGGCCAAGGTACAGCTTGG - Intronic
1145172877 17:20674767-20674789 GAAGGGGCCAATGTACAGCTTGG + Intergenic
1146149378 17:30453896-30453918 AAAGGGGCCAAGGTACAGCTCGG - Intronic
1148640737 17:49185390-49185412 AAAGGAGCCAACATAGAGCTTGG + Intergenic
1149051425 17:52309941-52309963 AAAGGGGCCAACGTAGAGCTTGG - Intergenic
1149052721 17:52325733-52325755 AAAGGGGCCAACATACAGCTTGG - Intergenic
1149072193 17:52556401-52556423 AAAGGGGCCAAGGTAGAGCTTGG + Intergenic
1149110235 17:53019490-53019512 TGAGAGGCCAACATACAGCTTGG - Intergenic
1149116039 17:53097623-53097645 AAAGGGGCCAAGGTACAGCTTGG + Intergenic
1149260693 17:54877002-54877024 AAAGGGGCCAAGGTACAGCTCGG + Intergenic
1149273189 17:55004873-55004895 AAAGGAGCAAATAAAGAGCTTGG + Intronic
1149341109 17:55687312-55687334 AAAGAGGCCAATATAGAGCTTGG + Intergenic
1149366773 17:55953022-55953044 AAAGGAGCCAACACAGAGCTTGG + Intergenic
1149370987 17:55993196-55993218 AAAGGGGCCAAGGTACAGCTCGG - Intergenic
1150523511 17:65895287-65895309 AAAGGACCCAGCAGAGAGCTTGG + Intronic
1150687367 17:67331569-67331591 AAAGGGGCCAAGGTACAGCTAGG + Intergenic
1150936093 17:69637271-69637293 AAATGGGAGAACAGAGAGCTTGG - Intergenic
1150941469 17:69698448-69698470 AAAGGGGCCAACATACAGCTTGG - Intergenic
1151041030 17:70861231-70861253 AAGGGGGCCAAGGTACAGCTCGG + Intergenic
1151135819 17:71945004-71945026 AAAGGGGCCAACATAGAACTTGG + Intergenic
1151501004 17:74488831-74488853 AAAGGGGCCAACATAGAGCTTGG - Intergenic
1151902019 17:77022578-77022600 AAAGGGGCCCAGGTACAGCTGGG + Intergenic
1152064070 17:78100484-78100506 AAAGGGGCCAAGGTACAGTTTGG - Intronic
1152967475 18:130080-130102 AAAGGGGCTAAGAGACAGCTTGG - Intergenic
1152989397 18:349265-349287 AAAGGGGCCAATGTGGAGCTGGG + Intronic
1153136894 18:1927447-1927469 AAAGGGGCCAAGGTACAGCTCGG + Intergenic
1153199320 18:2633119-2633141 AAAGGGGCCAACGTACAGCTTGG + Intergenic
1153214837 18:2809874-2809896 AATGGAAACAACATAGAGCTCGG - Intergenic
1153262873 18:3241378-3241400 AAAGGGGCCAAGGTACAGCTCGG + Intergenic
1153392086 18:4574000-4574022 ACAGGGGCCAAGGTACAGCTTGG + Intergenic
1153426890 18:4975005-4975027 AAAGGGGCCAATTTAAAGCTTGG - Intergenic
1153455040 18:5271433-5271455 AAAGAGGCCAAGATACAGCTTGG - Intergenic
1153539094 18:6135138-6135160 AAAGGGGCCAACATAAGGCTTGG - Intronic
1153663670 18:7349028-7349050 AAATGGTCCAACATGGCGCTTGG - Intergenic
1153846056 18:9050913-9050935 AAAGAGGCCAATGTACAGCTTGG + Intergenic
1154049748 18:10942919-10942941 AAAGGGGCCAACACAGAGCTTGG + Intronic
1154504377 18:15020875-15020897 AGAGGGGCCAAGGTACAGCTTGG - Intergenic
1154926507 18:20941969-20941991 AAAGGGGCTAAGAGACAGCTTGG + Intergenic
1154977586 18:21474600-21474622 AAAGGGGCCAATGTACAGCTTGG - Intronic
1155123075 18:22842509-22842531 GGAGAGGCCATCATAGAGCTGGG + Intronic
1155675625 18:28425687-28425709 AAAGGGGCCAACGTAGAGCTTGG + Intergenic
1155679643 18:28474043-28474065 AAAGGGGCCAATGTAGAGCTCGG + Intergenic
1155707858 18:28838375-28838397 AAAGAGGCCAAGGTACAGCTTGG - Intergenic
1155809067 18:30208574-30208596 AAAGGGGCCAAGGTACAGCTTGG - Intergenic
1155851682 18:30782530-30782552 AAAGGGACCAAGGTACAGCTTGG + Intergenic
1156081403 18:33340662-33340684 AAAGAGGCCAACATAGAGCTCGG + Intronic
1156243585 18:35276537-35276559 AAAGGGGCCAACGTAAAGCTCGG + Intronic
1156251004 18:35352571-35352593 ATAGGGGCCCAGATACAGCTTGG + Intergenic
1156265921 18:35488477-35488499 AAAGGGGCCAAGGTAGAGCTTGG - Intronic
1156467554 18:37357306-37357328 AAAGGGGCCAGCGTAGAGCTCGG + Intronic
1156583760 18:38409491-38409513 AAAGTGGTCAAGATACAGCTTGG + Intergenic
1156711902 18:39957621-39957643 AAAGAGGCCAAAATACAGCTCGG + Intergenic
1156817510 18:41328587-41328609 AAAGGGGCCAACATAGAGCACGG + Intergenic
1156892338 18:42204749-42204771 AAAGGGGCCAAGGTACAGCTTGG + Intergenic
1157781593 18:50444627-50444649 AAAGGGGCCAAGGTACAGTTTGG - Intergenic
1158061503 18:53348758-53348780 AAAGGTGCCAATGTAGAGATAGG - Intronic
1158129723 18:54139487-54139509 AAAGAGGCCAAGGTACAGCTTGG + Intergenic
1158222045 18:55160222-55160244 AAAGGGGCCCACATAGAGCTCGG + Intergenic
1158308095 18:56128350-56128372 AAAGGAAACAACACAGAGCTTGG - Intergenic
1158612688 18:58956688-58956710 AAAGGGGTCACCAGAGAACTGGG - Intronic
1158833255 18:61303372-61303394 AAAGGGGCCAACGTGCATCTGGG + Intergenic
1159083422 18:63760707-63760729 AAAGGGGCCAATGTACAGCTCGG + Intronic
1159157347 18:64601516-64601538 AAAGGGGAAAACATAGAGCTTGG - Intergenic
1159461207 18:68724114-68724136 AAAGGGGCCAAGGCATAGCTTGG - Intronic
1159508010 18:69360694-69360716 AAAGGGGCCAAGGTACAGCTTGG + Intergenic
1159705410 18:71679787-71679809 AAAGGGGCAAAAAGACAGCTTGG + Intergenic
1159761318 18:72430146-72430168 AAAGGGGTCAGCATAGAGCTCGG - Intergenic
1159765213 18:72480800-72480822 AAAGGGGCCAAAATAGAGCTTGG + Intergenic
1159962432 18:74566084-74566106 AAAGGGGCCAATGTACAGCTCGG - Intronic
1160599391 18:80001141-80001163 AAAGGGGCCAAGGTATAGCTTGG + Intronic
1160601362 18:80014988-80015010 AAAGGGGCCAACATACAGCTTGG - Intronic
1162296300 19:9816042-9816064 AAAGGGGCCAACGTATAACTCGG - Intronic
1162584375 19:11549998-11550020 ACAGGGTCCAACATAGAGCCGGG + Exonic
1162596487 19:11633515-11633537 AAAGGGGCGAACGTACAGCTTGG + Intergenic
1163056817 19:14726162-14726184 AAAGGGGCCCAGGTATAGCTTGG - Intronic
1165888408 19:39095903-39095925 TAAGGGGACAACATAGAGCTTGG - Intronic
1166410019 19:42550496-42550518 AAAGGGGCCAACATAGAGCTTGG + Intronic
1166900605 19:46058778-46058800 AAAGGGGCCAAGGTACAGCTGGG - Intronic
1167403465 19:49288503-49288525 AAAGGGGCCAACGTACAGCTCGG + Intergenic
1168296386 19:55379070-55379092 GAAGGGGCCAGCATAAGGCTAGG + Intergenic
1168377716 19:55894421-55894443 CAAAGGGGCAACATAAAGCTTGG + Intronic
1168496194 19:56853762-56853784 AAAAGGGCCAAGACACAGCTTGG + Intergenic
925035930 2:685841-685863 AAAGGGGCCAAGGTACAACTTGG + Intergenic
925453367 2:3990782-3990804 AGAGGGGCCAAGGTACAGCTCGG - Intergenic
925494868 2:4435559-4435581 AAAGGGGCCAAGGTACATCTTGG - Intergenic
925527029 2:4814216-4814238 AAAGGAGCCAAGGTATAGCTTGG - Intergenic
925669154 2:6293000-6293022 AAAGGGGCCAGAGTAGAGCCTGG + Intergenic
925805176 2:7641365-7641387 AAAGGGGCCAATGTACAGCTTGG - Intergenic
925817048 2:7763786-7763808 AAAGGGGTCAAGCTACAGCTTGG - Intergenic
925821173 2:7801218-7801240 AAAGGGGCCAAGGTACAGCTTGG + Intergenic
926448535 2:12973589-12973611 AAAGGGGCCAATGTAGAATTTGG - Intergenic
926461089 2:13130508-13130530 AAAGGGGCCAAGGTAAAGCTTGG + Intergenic
926468009 2:13215198-13215220 AAAGGGACCAATATAGAGTTTGG - Intergenic
926868958 2:17391508-17391530 AAAGGGGCCAAGGTACAGCTTGG + Intergenic
926870213 2:17407877-17407899 AAAGGGGCCAATGTAGTGTTTGG + Intergenic
926926472 2:17993205-17993227 AAAGGGGCCAAGGTACAGCATGG + Intronic
926929626 2:18023890-18023912 AAAGGGACCAAGGTACAGCTTGG - Intronic
926938920 2:18115027-18115049 AAAGGGGCCAAGGTACAGCTTGG + Intronic
926947419 2:18203449-18203471 AAAGTGGCCAATATAGAGCTTGG + Intronic
927100300 2:19783003-19783025 AAAGGGGCCAACATAGAGCTCGG + Intergenic
927394013 2:22628589-22628611 GAAGGGTCCAACATAGAGAATGG + Intergenic
927438234 2:23088768-23088790 AAAGGGGCCAAGGTACAGCTTGG - Intergenic
927605604 2:24483838-24483860 AAAGGGGCCAATGTACAGCTTGG + Intergenic
928048864 2:27968270-27968292 AAAGGGAACAATGTAGAGCTTGG + Intronic
928609904 2:32982686-32982708 AAAAGGGTCAAGATACAGCTCGG + Intronic
928731451 2:34237486-34237508 AAAGGGGCCGATGTAGAGCTTGG + Intergenic
928804369 2:35132668-35132690 AAAGGGGCCAAGGTACAGCTCGG - Intergenic
929275551 2:40021282-40021304 AATGGGGCCAAGGTACAGCTTGG + Intergenic
929358107 2:41050711-41050733 AAAGGGGCCAATATAGAGCCAGG + Intergenic
929376173 2:41289310-41289332 AAAGGGGCCAGAGTATAGCTTGG - Intergenic
929612806 2:43284394-43284416 AAAGGGGCCAAGGTACAGCTCGG + Intronic
930006760 2:46904027-46904049 AAAGGGGCCAACATACAGCTCGG + Exonic
930227843 2:48812452-48812474 AAAAGGGCCAAGGTATAGCTTGG - Intergenic
930254767 2:49077329-49077351 AAAGGAGCCAACATAGAGCTCGG - Intronic
930293964 2:49530309-49530331 AAAAGGGCCAAGATAGAGCTAGG - Intergenic
930299186 2:49593958-49593980 AAAGGGGCCAAAGTACAGCGTGG + Intergenic
930507722 2:52305287-52305309 AAAGGGACCAAGGTACAGCTAGG + Intergenic
930560122 2:52950164-52950186 AAAGGAACCAACGTAGAGCTTGG - Intergenic
930620378 2:53637423-53637445 ACAGGTGCCAATATAGAGTTTGG - Intronic
930812898 2:55561142-55561164 AAAGGAGCCAAGGTACAGCTTGG + Intronic
930831116 2:55744233-55744255 AAAGGGGCTAGCAGAGAGATGGG - Intergenic
930960149 2:57251592-57251614 AAAGGAGCCAAGGTACAGCTTGG - Intergenic
931033525 2:58211308-58211330 AAAAGGGCCAGTGTAGAGCTTGG - Intronic
931145036 2:59508078-59508100 AAAGGGGCCAATGTACAGCTTGG + Intergenic
931154102 2:59608139-59608161 AAAGGGGCCAACATACAGTTGGG + Intergenic
931154714 2:59615050-59615072 AAAGGGGCCAATGTAGAGCTTGG - Intergenic
932428308 2:71657715-71657737 AAAGGGGCCAATGTACAGCTTGG - Intronic
932552495 2:72785612-72785634 AAAGGGGCCAATGTATAGCTTGG - Intronic
932821648 2:74906544-74906566 AAAGTGGCCAACATACAGCTTGG - Intergenic
932847563 2:75151417-75151439 AAAGGGGCCAATGTACAGCTTGG + Intronic
932904424 2:75733906-75733928 AAAGGGTCCAATGTACAGCTTGG - Intergenic
932923291 2:75941878-75941900 AAAGGGGCCAACTTGAAGCTTGG + Intergenic
933008267 2:77023167-77023189 AAAGGGGCCAACATAGAGCTTGG - Intronic
933065015 2:77781693-77781715 AAAGGGGCCAACATAGAGCTCGG + Intergenic
933181285 2:79230345-79230367 AAAAGGGCCAAGGTACAGCTTGG + Intronic
933400912 2:81795491-81795513 AAAGGGTCCAACATAGAGCTTGG + Intergenic
933418788 2:82022456-82022478 AAAGGGGCCAACACAGGGCTTGG - Intergenic
933539080 2:83616084-83616106 AAAGGGGCCAAGGTACAGCTTGG + Intergenic
933578119 2:84092923-84092945 AAAGGGGACAATGTAGAGCTTGG - Intergenic
933790747 2:85882051-85882073 AAAGGGGCCAATGTACAGCTTGG + Intronic
933864165 2:86500704-86500726 AAAGGGGCCAAGGTACAGCTTGG - Intergenic
933947209 2:87297019-87297041 AAAGGGGCCAAGATACAGCTCGG - Intergenic
934054980 2:88243915-88243937 AAAGGGGCCAAGGTACAGCTTGG + Intergenic
934106926 2:88703523-88703545 AAAGGGGCCAATGTAGAGCTCGG - Intronic
934112997 2:88759623-88759645 AAAGGGGCCAAGATACCGCTTGG + Intergenic
934610597 2:95732489-95732511 AAAGGGGCCAACGTAGCACTCGG - Intergenic
935481422 2:103594748-103594770 TAAGGGGCCAAGGTACAGCTTGG + Intergenic
935625984 2:105172666-105172688 AAGGGGGCCAATGTACAGCTTGG - Intergenic
936332983 2:111564549-111564571 AAAGGGGCCAAGATACAGCTCGG + Intergenic
936470108 2:112791362-112791384 AAACGGGCCAAGATAGAGCTTGG + Intergenic
936543938 2:113374071-113374093 AAAGGGGCCAATGTAGCACTCGG - Intergenic
936630876 2:114201452-114201474 AAAGGGGTTAACAAAAAGCTTGG - Intergenic
936683734 2:114804084-114804106 AAAGGGGCCAATGTACAGCTTGG + Intronic
936685527 2:114822297-114822319 AAAGGGGCCAAGGTACAGATTGG - Intronic
936788537 2:116123956-116123978 AAAGGGGCCAAGGTACAGCTTGG + Intergenic
936792296 2:116164489-116164511 AAAGGGGCCAATGTAGAGCTTGG + Intergenic
936822742 2:116542737-116542759 AAAGGGGGCAAGGTAGAGCTTGG - Intergenic
936827777 2:116602805-116602827 AAAGGGGCCAACATAGAGCTTGG + Intergenic
936862377 2:117032971-117032993 AAAGGGGCCAAGGTAAAGCTTGG - Intergenic
936969622 2:118164676-118164698 AAAGGGGTCAATGTAGAGCTTGG + Intergenic
937380729 2:121374195-121374217 AAAGGGGCCAACGTACAGCTTGG + Intronic
937427628 2:121813373-121813395 AAAGGGGCCAAGGTACAGCTCGG + Intergenic
937473075 2:122190258-122190280 AAAGCCACCAACAGAGAGCTGGG - Intergenic
937527498 2:122788791-122788813 AAAGGGGCCAAGGTACATCTTGG + Intergenic
937730346 2:125222690-125222712 AAAGAGGCCAAGGTAGAGCTTGG - Intergenic
937751023 2:125476540-125476562 AAAGGGGTCAACACAGAGCTTGG + Intergenic
937806515 2:126151337-126151359 AAAGGGGCCAAAGTAAAGCTTGG - Intergenic
937827905 2:126388134-126388156 AAAGGGGCCAAGTTATAGCTTGG + Intergenic
937881282 2:126866702-126866724 AAAAGGGCCAAAGTAAAGCTTGG - Intergenic
938165361 2:129021223-129021245 AAAGGGGCTAAGGTACAGCTTGG + Intergenic
938503565 2:131851081-131851103 AGAGGGGCCAAGGTACAGCTTGG - Intergenic
938686403 2:133742308-133742330 AAAGGGACCAACGTAGAGCTTGG - Intergenic
938689956 2:133778467-133778489 AGAGGAGCCAACAAAGAGCCAGG - Intergenic
938718179 2:134039973-134039995 AAAGGGGCAAAGGTACAGCTTGG - Intergenic
938850002 2:135250625-135250647 AAAGGGGCCGACGTACAGCTTGG + Intronic
938868876 2:135453165-135453187 AAAGGGGCCACTGTAGAGCTTGG - Intronic
939079158 2:137639234-137639256 AAAGGGGCCAACATGAAGCTCGG + Intronic
939092847 2:137799369-137799391 AAAGGAGACAAGATACAGCTTGG + Intergenic
939272595 2:139959838-139959860 AATGGGGTCAATATAGAGTTTGG + Intergenic
939287711 2:140154380-140154402 AAAGGGGTCAGTGTAGAGCTCGG - Intergenic
939506386 2:143052571-143052593 AAAGGGGCCAAGGTACAGCTTGG + Exonic
939559295 2:143714269-143714291 AAAGGGGCCAACGTAGAGTTTGG - Intronic
939694953 2:145312374-145312396 AAAGGGGCCAACATAGAGTTTGG - Intergenic
939752443 2:146064167-146064189 AAAGGGGCAAACATAGAGCTTGG - Intergenic
939758024 2:146137748-146137770 AAAGGGGCCAAGGTACATCTTGG - Intergenic
939784661 2:146494582-146494604 AAAGGGGCCAAGGTACAACTTGG - Intergenic
939835546 2:147125486-147125508 AAAGGGGCCAAGGTACAGCTTGG + Intergenic
939847808 2:147269038-147269060 AAAGGGGCCAAGGTACAGCTTGG - Intergenic
940149055 2:150578849-150578871 AAAGGGGCCCAGATACAGTTTGG - Intergenic
940288905 2:152058936-152058958 AAAGGGGCGAAGGTACAGCTTGG + Intronic
940402893 2:153267524-153267546 AAAGGGGCCAAGATACAGCTTGG - Intergenic
940408773 2:153335954-153335976 AAAGGGGCCAATGTAGAGCTTGG + Intergenic
940547185 2:155102534-155102556 AAAGGGGCCAAGGTACAGCTTGG - Intergenic
940596194 2:155795862-155795884 AAAGGGGCCAAGGTATAACTCGG - Intergenic
940699496 2:157023618-157023640 AAAGGGGCCAACATAGAGCTTGG + Intergenic
940729813 2:157375739-157375761 AAAGGGGCCCAGGTACAGCTTGG - Intergenic
940888859 2:159015290-159015312 AAAGGGGCCAACGTAGAGCTTGG - Intronic
941083144 2:161085858-161085880 AAAGGAGGCAACATACAACTGGG + Intergenic
941256738 2:163241377-163241399 ATAGAGGCCAATACAGAGCTTGG + Intergenic
941307793 2:163892403-163892425 AAAAGGGCCAATGTACAGCTTGG - Intergenic
941319921 2:164041556-164041578 AAAGGGGCCAAAATATAGCTTGG - Intergenic
941335699 2:164240928-164240950 AAAGGGGCCAAGGTAAAGCTCGG - Intergenic
941424078 2:165320696-165320718 AAAGGGGCAAATGTAGAGCTAGG - Intronic
941490605 2:166138460-166138482 AAAGGGGCCAACATAGTGCATGG + Intergenic
941535997 2:166722971-166722993 AAAGGGGCCAATATGGAGCTTGG - Intergenic
941560280 2:167035915-167035937 AAAGGGCCCAACATACAGCTTGG + Intronic
941570281 2:167161546-167161568 GAAGGGGCCAACATAGAGCCTGG - Intronic
942123778 2:172803408-172803430 AAAGGGGCCATGGTACAGCTCGG - Intronic
942234301 2:173889483-173889505 AAAGGGGCCAACGTACAGCTTGG + Intergenic
942281126 2:174364721-174364743 AAAGAGGCCAATGTAGATCTTGG - Intronic
942601326 2:177643854-177643876 AAAGGGGCCAAGGTACAGCTTGG + Intronic
942724769 2:178994395-178994417 AAAGGGACCAACACAGAGCTTGG - Intronic
942733375 2:179082884-179082906 AAAGGGACCAAGGTACAGCTTGG - Intergenic
942904754 2:181167032-181167054 AAAGGGGCCAAGGTACCGCTGGG - Intergenic
942950067 2:181712158-181712180 AAAGGGGCCAAGGTACAGCTTGG + Intergenic
943072220 2:183154052-183154074 AAAGGGGACAATGTAGAGCCTGG - Intronic
943124760 2:183782655-183782677 AAAGGGACCAAGGTACAGCTTGG + Intergenic
943205317 2:184886725-184886747 AAAGGGGCCAACATACAGCTTGG - Intronic
943219819 2:185090466-185090488 AAAGGGGCCAATTTAGAGCTTGG + Intergenic
943238014 2:185347638-185347660 AAAGGGGCCAGCAGACAGCTCGG + Intergenic
943251200 2:185523399-185523421 AAAGGGGCCAATGTACGGCTTGG + Intergenic
943271552 2:185811791-185811813 AAAGGGGCCCAGTTACAGCTTGG + Intronic
943313210 2:186353358-186353380 AAAGGGGCCAAGGTACAGCTTGG + Intergenic
943406415 2:187493279-187493301 AAAGGGGTCAACGTAGAGCTAGG - Intronic
943417775 2:187630355-187630377 AAAGGGGCCAATGTAGAGCTTGG + Intergenic
943427378 2:187752940-187752962 AAAGGGGCCTACGTACAGCTTGG - Intergenic
943511234 2:188830256-188830278 AAAGGAACCAACAGAGAACTCGG + Intergenic
943622766 2:190168218-190168240 AAAGGGGCTAAGGTATAGCTGGG - Intronic
943776727 2:191774282-191774304 AAAGGGGCCAAGGTACAGCTTGG + Intergenic
943788154 2:191901378-191901400 AAAGAGGCCAAGGTACAGCTTGG + Intergenic
944101374 2:196031225-196031247 AAAGGGGCCAACGTGGAGCTTGG - Intronic
944106359 2:196083600-196083622 AAAGGGGCCAAGGTACAGCTCGG + Intergenic
944371207 2:198985639-198985661 AAAGGGGCAAAGGTACAGCTTGG - Intergenic
945089769 2:206168053-206168075 AAAGGGTCCAGCGTAGAGCTTGG - Intergenic
945324928 2:208471447-208471469 AAAGGGGCCAATGTAGAGCTTGG + Intronic
945709467 2:213278052-213278074 AAAGGGGCCAAAGTAGAGCTTGG + Intergenic
945760074 2:213903458-213903480 AAAGGGGCCAACGTAGAGCTTGG - Intronic
945767558 2:213999300-213999322 AAAGGGTCCAATGTAGAGCTTGG + Intronic
946317160 2:218923941-218923963 AAAGGGGCCAAGGTACAGCTCGG - Intergenic
946930137 2:224662769-224662791 AAAGGGGCCAATGTACAGTTCGG - Intergenic
946988606 2:225302692-225302714 AAAGGGGCCAATGTAGAGGTTGG + Intergenic
946995285 2:225384156-225384178 AAAGGGGCCAATATATAGCTTGG + Intergenic
947011526 2:225571553-225571575 AAAGGGGCCAAGGTACAACTCGG - Intronic
947328075 2:228999620-228999642 AAAGGGGCCAATGTACAGCTTGG + Intronic
947328500 2:229003542-229003564 AGAGGAGGCAACAGAGAGCTTGG - Intronic
947345616 2:229186542-229186564 AAAGGGGCCAACATAGAGCTTGG - Intronic
947443154 2:230141005-230141027 AAGGGGGCCAAAGTACAGCTTGG + Intergenic
947443629 2:230145305-230145327 AAAGGGGATAACTTAGACCTAGG + Intergenic
947646877 2:231748783-231748805 AAAGGGGCCAATGTACAGCTCGG + Intronic
947889655 2:233605707-233605729 AAAGGGCCCCAGATACAGCTTGG - Intergenic
947951662 2:234152890-234152912 AAAGGGGCCAAAGTACAGCTTGG - Intergenic
948346529 2:237303528-237303550 AAAGGAGCCAACATAGAGCTTGG + Intergenic
1169285689 20:4305388-4305410 AAGGAGGCCAACAAAGAGGTGGG - Intergenic
1169609663 20:7364677-7364699 AAAGAGGCCAAGGTACAGCTTGG + Intergenic
1169676363 20:8159296-8159318 AAAGGGGCCAATATAGAACATGG - Intronic
1169766405 20:9152451-9152473 AAAGGGGCTAACATAGAGCTTGG + Intronic
1169858011 20:10124333-10124355 AAAGGAGCCAATGTAGAGGTTGG - Intergenic
1169985234 20:11436211-11436233 AAAGGGGCCAAAGTACAGCTTGG - Intergenic
1169999264 20:11596622-11596644 AAAGGGGCCAACTTGCAGCTTGG - Intergenic
1170310055 20:14982579-14982601 AAAGGGGCCAACGCAGAGCTTGG + Intronic
1170313530 20:15017798-15017820 AAAGGGGCCAACATAAAGCTTGG - Intronic
1170474997 20:16706019-16706041 AAAGGGGCCAACATAGAGCGTGG + Intergenic
1170499644 20:16961367-16961389 AAAGGGGCCAACTTAGAGCTTGG - Intergenic
1170643898 20:18179550-18179572 AAAGGGGCCAAGGTACAGCTCGG - Intronic
1171130130 20:22644670-22644692 AAAGGGGCCAATGTAGAGCTTGG - Intergenic
1172063781 20:32205730-32205752 AAAGGGCTCAGCACAGAGCTTGG + Intronic
1172200463 20:33122545-33122567 AAAGGGGCCAACATACAGCTTGG + Intergenic
1172305602 20:33878104-33878126 AAGGGAGCCATCAAAGAGCTGGG - Intergenic
1172612540 20:36262558-36262580 AAAGGGCCTAACATAGTGCCCGG - Intronic
1172720241 20:36994495-36994517 GAAGGGGTCAATGTAGAGCTTGG + Intergenic
1173225378 20:41159570-41159592 AAAGAGGCCAAGATCAAGCTGGG - Intronic
1173314668 20:41932574-41932596 AAAGGGTCCCACATATAGCTCGG + Intergenic
1175195391 20:57239813-57239835 AAAGGGGTCAATGTACAGCTTGG - Intronic
1175603001 20:60289986-60290008 AAAGGGCCCCAGATACAGCTTGG - Intergenic
1175688180 20:61046364-61046386 AATGGGGCCAGCCTAGAGCAAGG + Intergenic
1176657723 21:9602717-9602739 AAAGGAGCCAAGGTACAGCTTGG - Intergenic
1176783389 21:13226618-13226640 CAAAGGGCCAATGTAGAGCTTGG + Intergenic
1176935385 21:14860918-14860940 AAAGGGGCCAATGTAGAGCTCGG - Intergenic
1177026348 21:15925716-15925738 AAAGGGGCCAAGTTACGGCTTGG - Intergenic
1177106442 21:16961871-16961893 AAATGGGCAAAGATAGTGCTGGG - Intergenic
1177169591 21:17640651-17640673 AAAGGGGCTAAGGTACAGCTTGG - Intergenic
1177204862 21:17998699-17998721 AAAGGGGCCAACGTAGAGCTTGG - Intronic
1177288157 21:19077804-19077826 AAAGGGGCCAATGTAGAGCTTGG + Intergenic
1177339791 21:19784019-19784041 AAAGGGGCCAAGGTACAGCTCGG - Intergenic
1177393217 21:20502408-20502430 AAAGGGGCCAACATACATCTTGG - Intergenic
1177394108 21:20511008-20511030 AAAGGGGACAACATACAGCTTGG - Intergenic
1177478142 21:21650991-21651013 AAAGGGGTACACCTAGAGCTTGG + Intergenic
1177479629 21:21669700-21669722 AAAAGGGCCAAGGTAGAGCTCGG - Intergenic
1177496158 21:21894869-21894891 AAAGGGGCCAAGGTACAGCTTGG - Intergenic
1177504318 21:22000845-22000867 AAAGGGGCCAACACAGAGTTTGG - Intergenic
1177554507 21:22672186-22672208 AAAGGGGCCATTGTAGAGTTTGG + Intergenic
1177656175 21:24020186-24020208 AAAGGGGCCAAAGTACAGCTTGG + Intergenic
1177839268 21:26218178-26218200 AAAGGGGCCAACATAGAGCTCGG + Intergenic
1177981033 21:27915385-27915407 CAAAGGGCCAATGTAGAGCTTGG + Intergenic
1178099603 21:29253306-29253328 AAAGGGTCCAACATACAGCTTGG - Intronic
1178224509 21:30699810-30699832 AAAGGGGCCAAGGTACAGCTTGG - Intergenic
1178338593 21:31766165-31766187 AAAGGGGCCAAGGTACAGCTCGG + Intergenic
1179384464 21:40929265-40929287 TAAGGGGCCAAGGTACAGCTTGG - Intergenic
1179450168 21:41463165-41463187 AAAGGGGCCAAAATAGAGCTTGG + Intergenic
1179527913 21:41995856-41995878 AAAGGGGCCAAGGTACAGCTTGG + Intronic
1180685708 22:17664800-17664822 AAAGGGGCCAAGGTACAGCTCGG - Intronic
1182330188 22:29546126-29546148 AAAGGGGCCAATCTAGAGCTTGG - Intronic
1182815159 22:33155918-33155940 AAAGGGGCCAAGGTACAGCTCGG + Intergenic
1182982831 22:34687713-34687735 AAAGGACCTAACACAGAGCTGGG - Intergenic
1184061632 22:42086189-42086211 ATCGTGGCCAACATAGAACTTGG + Exonic
1184311914 22:43651287-43651309 AAAGGGGCCAATTTAGAGCTTGG + Intronic
1184713273 22:46265672-46265694 AAAAAGGCCAATGTAGAGCTCGG - Intergenic
1185240471 22:49740480-49740502 AAAGGGGTCACAGTAGAGCTCGG + Intergenic
949662194 3:6292042-6292064 AAAGGGGCAAAGGTACAGCTTGG - Intergenic
949692993 3:6662238-6662260 AAAGGGGCCAAGGTACAGCTTGG - Intergenic
950103839 3:10375905-10375927 AAAGTGCCCAGCATAGTGCTCGG + Intronic
950412195 3:12846257-12846279 AAAGGGGCCAAGGTACAGCTTGG + Intronic
950700708 3:14743803-14743825 AAAGGGGCCAACATATAGCTTGG - Intronic
950800727 3:15550165-15550187 AAAGGGGCCAACATACAGCTCGG + Intergenic
950825251 3:15812216-15812238 AAAGATGGCATCATAGAGCTGGG + Intronic
950853124 3:16081733-16081755 AAAGGGGCCAAGGTACAACTTGG - Intergenic
951037649 3:17951463-17951485 AATGGGGCCAAGGTACAGCTCGG + Intronic
951093100 3:18598097-18598119 AAAGGAGCCAATGTAGAGCTTGG - Intergenic
951127041 3:18996308-18996330 AAAGGGGCCAACATACAGCTTGG - Intergenic
951258053 3:20473972-20473994 GAAGGGGCCAACAGATTGCTTGG + Intergenic
951289993 3:20863460-20863482 AAAGAGGCTAATGTAGAGCTTGG - Intergenic
951324559 3:21286448-21286470 AAAGGGGCCAAGATACAGCTCGG + Intergenic
951446167 3:22782729-22782751 AAAGGGGCCAAGGTACAGCTTGG - Intergenic
951452219 3:22852456-22852478 AAAGGGGCCAAGGTATAGCTTGG - Intergenic
951920849 3:27852722-27852744 AAAGGAGCCAAGGTACAGCTTGG - Intergenic
952094261 3:29929876-29929898 AAATGGGGCAAACTAGAGCTGGG - Intronic
952096528 3:29960772-29960794 AAAGGGGCCAAGGTACGGCTTGG - Intronic
952105555 3:30065672-30065694 AAAGGGGCCAGTGTAGACCTTGG - Intergenic
952185250 3:30961284-30961306 AAAGGGGCCAACATAGAGCTCGG - Intergenic
952188159 3:30993108-30993130 AAAGGGGCCCAGTTACAGCTCGG - Intergenic
952202670 3:31147631-31147653 AAAGGGGCCAAGGTACAGCTTGG - Intergenic
952401206 3:32965836-32965858 AAAGGGGCCAAGGTATAGCTGGG + Intergenic
952435267 3:33267187-33267209 AAAGGGGCCAAGGTACAGCTTGG - Intergenic
952541266 3:34370618-34370640 AAAGGGGCCAGTGTAGAGCTTGG + Intergenic
952715099 3:36472205-36472227 AAAGGGGCCAATGTAGAGCTTGG - Intronic
953184954 3:40629277-40629299 AAAGGGGCCTAGGTACAGCTTGG + Intergenic
953446611 3:42974069-42974091 AAAGGGTCCAATATAGAGCTTGG + Intronic
953685773 3:45077453-45077475 AAAGGGGCCAATGTAGAGCGTGG + Intergenic
954516916 3:51186730-51186752 AAAGGGGCCAATGTAAACCTTGG + Intronic
954911798 3:54116992-54117014 AATGGGGCCAACATACAGCTTGG + Intergenic
955113353 3:55972210-55972232 AAAGGGAGAAACATGGAGCTGGG + Intronic
955395527 3:58554470-58554492 AAGGGGGCCAAGGTACAGCTTGG - Intergenic
955826282 3:62951329-62951351 AAAGGGGCCAAGGTACAGCTTGG + Intergenic
956169560 3:66421994-66422016 GAAAGGGGCAACATAGAGCACGG - Intronic
956327533 3:68070328-68070350 AAATGGGCCAAGGTATAGCTCGG - Intronic
956375431 3:68608848-68608870 AAAGGGGCCAAAGTACAGCTTGG - Intergenic
956391626 3:68779561-68779583 CAAGGGGCCAAAGTACAGCTGGG + Intronic
956474942 3:69609951-69609973 AAAGGGACCAATGTAGAGCTTGG + Intergenic
956503242 3:69910143-69910165 AAAGGGGCCAACATAGAGCTTGG + Intronic
956546391 3:70408062-70408084 AAAGAGACCAACCTAGAGCTTGG - Intergenic
956558819 3:70551182-70551204 AAAGGGACCAACATAGAGCTCGG - Intergenic
956910018 3:73807563-73807585 AAAGGGGCCAATGTACAGCTCGG + Intergenic
957030549 3:75235904-75235926 AAATGGTCCAAGATACAGCTTGG + Intergenic
957145067 3:76413094-76413116 AAAGGGGCCAATGTACAGCTTGG - Intronic
957148737 3:76457852-76457874 AAAGGGGCCAAGGTACAGCTTGG - Intronic
957160314 3:76601562-76601584 AAAGGGGCCAAGGTACAGCTTGG - Intronic
957260635 3:77897226-77897248 AAAGGGGCAAACGTAGAGCTTGG - Intergenic
957276081 3:78093195-78093217 AAAGGGGTCAAGGTACAGCTTGG + Intergenic
957474430 3:80705373-80705395 AAAAGGGCCAAGGTACAGCTTGG - Intergenic
957477130 3:80739554-80739576 CAAGGGGCCAAGGTACAGCTTGG - Intergenic
957490568 3:80921573-80921595 AGAGGGGCCAAGGTATAGCTTGG + Intergenic
957630539 3:82711331-82711353 AAAGGGGTCAAGGTACAGCTTGG - Intergenic
957669416 3:83281200-83281222 AAAGGGGACAATGTAGAGTTTGG - Intergenic
957703983 3:83755918-83755940 AAAAGGGCCAACGTAGAGCTTGG + Intergenic
957765748 3:84621928-84621950 AAAGGGGCCAAGGTACAGCTTGG - Intergenic
957870331 3:86083279-86083301 AAAGAGGCCAATGTACAGCTTGG - Intergenic
957935333 3:86935136-86935158 AAAGGGCCCAACATAGAGGCTGG - Intergenic
957953179 3:87150264-87150286 AAAGGGGCCAAGGTAAAGCTTGG - Intergenic
957981711 3:87519550-87519572 AAAGGAGCCAACATAGAGCCTGG + Intergenic
958018390 3:87968939-87968961 AAAGGGACCAAGGTACAGCTTGG + Intergenic
958042586 3:88244650-88244672 AAAGGGGCCAAGGTGCAGCTTGG + Intergenic
958065927 3:88544911-88544933 AAAGGGGCCAAGGTACAGCTTGG + Intergenic
958128365 3:89386391-89386413 AAAGAGGCCAAGGTATAGCTTGG + Intronic
958146514 3:89631521-89631543 AAAGGGGCCAATGTACAGCTTGG + Intergenic
958149386 3:89670708-89670730 AAAGGGGCCAGCGTAGAAGTTGG + Intergenic
958154069 3:89730592-89730614 AAAGGGGCCAAGGTACAGCTCGG + Intergenic
958157328 3:89771526-89771548 GAAGGGGCCAAGGTACAGCTTGG - Intergenic
958550600 3:95607367-95607389 AAAGGGGCAAATATAGACCTTGG - Intergenic
958604348 3:96338890-96338912 AAAGGGGCCAAGGTACAGCTCGG + Intergenic
958611914 3:96436861-96436883 AAAGGGGCCAATGTACAGCTCGG - Intergenic
958638912 3:96779737-96779759 AAAGGGGCCAACATAGAGTTTGG + Intergenic
958672193 3:97219526-97219548 AAAGGGGCCAAGGTACAGCTTGG - Intronic
958710207 3:97708805-97708827 AAAGAGGCCAAGGTACAGCTCGG + Intronic
958825467 3:99025093-99025115 AAAGGGGACAAAACAGAACTAGG - Intergenic
958887189 3:99739629-99739651 AAAGGGGCCAAGGTACAGCTTGG - Intronic
958893459 3:99805249-99805271 AAAGGGGCCCAGGTACAGCTTGG - Intergenic
959004869 3:101008700-101008722 AAAGGGGCCAATGTAGAGCTGGG - Intergenic
959054440 3:101553669-101553691 AAAGGGGCAAACAAAGAGCTTGG + Intergenic
959171380 3:102848139-102848161 AAAGGGGCCAAGGTACAACTCGG - Intergenic
959183195 3:103008047-103008069 AAAGGGGCCAAGGTACAGCTTGG - Intergenic
959235681 3:103718761-103718783 AAAAGGGCCAAGGTAGAGCCTGG - Intergenic
959342559 3:105149311-105149333 AAAGGGGCCAATGTACAGCTTGG - Intergenic
959357964 3:105355787-105355809 AAAGGGGCAAATATACAACTAGG + Intergenic
959624320 3:108432689-108432711 AAAGGGGTCAACATAGAGCTTGG + Intronic
959742580 3:109737571-109737593 AAAGGGGCCAAGGTACAGCTCGG - Intergenic
959803566 3:110524808-110524830 AAAGGGGCCAACATAGAGCTTGG + Intergenic
959851790 3:111096682-111096704 AAAGTGGCCAAGGTACAGCTCGG + Intronic
959893673 3:111583704-111583726 AAAGGGGCCAACGTGCAGCTTGG - Intronic
959915847 3:111815960-111815982 AAAGGAGCCAACATAGAGCTTGG + Intronic
959968387 3:112381446-112381468 AAAGGGGCCAACATAGAGCTCGG + Intergenic
959973402 3:112431923-112431945 AAAGGGTACAACATAGAGCTTGG + Intergenic
959975483 3:112454164-112454186 AAAGTGGCAAAGATAAAGCTGGG + Intergenic
960060214 3:113312735-113312757 AAAGGGAAAAACATAGAGGTGGG + Intronic
960496721 3:118384009-118384031 AAAGGGGCCATCTTACAGCTCGG + Intergenic
960881893 3:122353811-122353833 AAAGGGGCCCACACAGAACTGGG + Intergenic
961029722 3:123591053-123591075 AAAGGGGCCAAGGTACAGCTTGG - Intergenic
961067814 3:123891072-123891094 AAAGGGGCCAATATAGAGCTTGG - Intergenic
961471568 3:127116472-127116494 AAAGGGGCCTACAGAGGCCTTGG - Intergenic
961503831 3:127356937-127356959 AAAGGGGCTAAGATACAGCTTGG - Intergenic
962045758 3:131757843-131757865 AAAGGGGACAACATACAGCTTGG + Intronic
962057328 3:131886219-131886241 AAAGGGGCCAATGTGGAGCTTGG + Intronic
962440207 3:135406424-135406446 AAAGGGGCCAACATAGAACTCGG - Intergenic
962589311 3:136872769-136872791 AAAGGGGCCAGCGTAGAGCTTGG + Intronic
962659400 3:137585938-137585960 AAAGGGGCCAACGTAGAACTCGG - Intergenic
962769941 3:138602793-138602815 AAAGAGGCCAACATAGAGCTTGG + Intergenic
963022499 3:140885930-140885952 AAAGGGGCCAACACAGAGCTTGG + Intergenic
963072845 3:141319150-141319172 AAAGGGGCCAATGTAGAGCTTGG - Intergenic
963368441 3:144367705-144367727 AAAGGGGCCAACATAGAGCTTGG - Intergenic
963421064 3:145061511-145061533 AAAGGGGCCAAGGTATAGCTCGG - Intergenic
963548013 3:146685606-146685628 AAAGGGGTCAACATAGAGCTTGG - Intergenic
963640726 3:147858474-147858496 AAAGGGCCCAAAGTATAGCTTGG - Intergenic
963716666 3:148811575-148811597 AAAGGGGCCAACATAGAGCTTGG + Intronic
963777340 3:149452386-149452408 AAAGGGGCCCAGGTAGAGCTTGG - Intergenic
964026457 3:152080120-152080142 AAAGAGGCCAAGGTACAGCTTGG - Intergenic
964088506 3:152846801-152846823 AAAGGGCCCAATGCAGAGCTTGG + Intergenic
964271236 3:154958734-154958756 AAAGGGGCCAAGGTACAGCTTGG - Intergenic
964427384 3:156568174-156568196 AAAGGGGTCAGCATATAGCTTGG + Intergenic
964457016 3:156879783-156879805 AAAGGCGCCAAGGTACAGCTCGG + Intronic
964491150 3:157237660-157237682 AAAGGGGCCTCCATGGAGCTGGG - Intergenic
964508545 3:157425115-157425137 AAAGGGGCCAAAGTACAGCTCGG + Intronic
964737828 3:159934348-159934370 AAAGGGGCCAAGATACAGCTTGG - Intergenic
964836147 3:160940538-160940560 AAAGGGGCCAATGTACAGCTCGG + Intronic
964895551 3:161590883-161590905 AAAGGGGCCAACATACAACATGG - Intergenic
964910759 3:161777184-161777206 ATAGGAGCCAATGTAGAGCTTGG + Intergenic
965086923 3:164111957-164111979 GAAGGAACCAACATACAGCTTGG - Intergenic
965146587 3:164913026-164913048 AAAGGTGCCAACATAGAGCTTGG - Intergenic
965189197 3:165506533-165506555 AAATGGGCCAAGGTACAGCTTGG - Intergenic
965203657 3:165692946-165692968 AAAGGGGCCAACACAGAGCTTGG - Intergenic
965234002 3:166091298-166091320 AAAGGGGTCAAGATACAGCTTGG - Intergenic
965326385 3:167309594-167309616 AAAGGGGCCAAGATACAGCTTGG - Intronic
965349621 3:167597219-167597241 AAAGGGGCCAAGGTACAGCTAGG + Intronic
965363141 3:167765402-167765424 AAAGGGGACAATGTAGAGCTTGG - Intronic
965386877 3:168056171-168056193 AAAGGCACCAACATAGAGCTTGG + Intronic
965458202 3:168930043-168930065 AAAGGGGCCAGTGTAGAGCTTGG - Intergenic
965499995 3:169445357-169445379 AAAGGAACAAACATAGAGCTTGG + Intronic
965647291 3:170897506-170897528 AAAGGGGTCAAGGTACAGCTTGG + Intronic
965662106 3:171052798-171052820 AAAGAGGCCAAAGTACAGCTTGG + Intergenic
965838801 3:172880467-172880489 AAAGGGGCCAAGGTACAGCTTGG + Intergenic
965864043 3:173183275-173183297 AAAGGGGCCAATGTAGAGGTTGG + Intergenic
965957615 3:174389723-174389745 AAAGGGGCCCAGGTAGAGCTTGG - Intergenic
965968930 3:174529765-174529787 AAAGGGGCCAACATAGAGCCTGG - Intronic
966074965 3:175924840-175924862 AAAGGGGCCAATGTACAGCTTGG - Intergenic
966115670 3:176458199-176458221 AAAGTGGCCAATGTAGAACTGGG + Intergenic
966123408 3:176548109-176548131 AAAGGGGCCAACATAGAGCTCGG - Intergenic
966153582 3:176892301-176892323 AAAGGGACCAAGGTACAGCTTGG + Intergenic
966241357 3:177758040-177758062 AAAGTGGCCAAGGTACAGCTTGG - Intergenic
966320367 3:178695170-178695192 AAAGGGGCCAAGGTACAGCTAGG - Intronic
966466278 3:180233985-180234007 AAAGGGGCTAACATACAGCTTGG - Intergenic
966512194 3:180776571-180776593 ACAGGGGCCAAGGTACAGCTCGG - Intronic
966665057 3:182463218-182463240 AAAGGGGCCAACATAGAGCTTGG + Intergenic
966733353 3:183168711-183168733 AAAGGGGCCAATGCATAGCTTGG - Intergenic
966972800 3:185060920-185060942 AAAGGGGCCAAGATACGGCTTGG + Intergenic
967155003 3:186684042-186684064 AAGGGGGCCAATGTAGAGCTTGG - Intergenic
967260246 3:187634734-187634756 AAAGGGGCCCAGGTACAGCTTGG - Intergenic
967396562 3:189015696-189015718 AAAGGGGCCAGGATACAGCTTGG + Intronic
967450013 3:189613298-189613320 AAAGGGGCCAACACACACCTTGG + Intergenic
967509434 3:190292333-190292355 AAAGGGGCCAAGGTACAGCTTGG - Intergenic
967565013 3:190962605-190962627 AAAGGAGCCAATGTAGAGCTTGG + Intergenic
967586101 3:191216190-191216212 AAGGGGGCCAACATACAGATAGG - Intronic
967633858 3:191778184-191778206 AAAGGGGTCAAGGTACAGCTTGG + Intergenic
967689520 3:192457973-192457995 AAAGTGGCCAACATAAAGCTTGG + Intronic
967697855 3:192554137-192554159 ACAGAGGACAAAATAGAGCTGGG + Intronic
967717116 3:192775219-192775241 AAAGGGGTCAATGTGGAGCTTGG + Intergenic
967908295 3:194520042-194520064 AAAGGGCCCAAGGTACAGCTCGG + Intergenic
968014697 3:195319057-195319079 AAAGAGGCCAAGGTACAGCTCGG + Intronic
968175909 3:196549346-196549368 AAAGGGGCCAACATAGAGCTTGG + Intergenic
968265550 3:197360348-197360370 AAAGGGGCCAAAGTACAGCTTGG + Intergenic
968392216 4:203102-203124 AAAGGGGCCAAGGTACAACTTGG + Intergenic
969163218 4:5279830-5279852 AAAGGGGCAAAGGTACAGCTTGG - Intronic
969782786 4:9422594-9422616 AATGGGGCCGAAATAGAGTTAGG + Intergenic
969993076 4:11284029-11284051 AAAGGGGGCAATGTAGACCTTGG - Intergenic
969997056 4:11324062-11324084 AAAGGGGCCAAAGTACAGCTGGG + Intergenic
970057648 4:11993766-11993788 AAAGCAACCAACATACAGCTAGG + Intergenic
970073828 4:12195358-12195380 AAAGGGGCCCAGATACAGCTTGG - Intergenic
970222506 4:13825301-13825323 AAAGGGGTCAACATGGAGCTCGG + Intergenic
970307979 4:14752701-14752723 AAAGAGGCCAAGGTACAGCTTGG - Intergenic
970339164 4:15086340-15086362 AAAGAAGCCAACATAGAGCTTGG - Intergenic
970635544 4:18005720-18005742 AAAGGGGCCAACATAGAGCTCGG - Intronic
970659230 4:18265264-18265286 AAGCGGGCCAACATACAGTTCGG - Intergenic
970678289 4:18477435-18477457 AAAGGGGCCAAGGTACAGCTCGG - Intergenic
970742037 4:19250511-19250533 AAAGGGGCCAACCTACAGCTTGG + Intergenic
970756827 4:19437253-19437275 AAAGGGGCCAAGGTATAGCTTGG + Intergenic
970763259 4:19516957-19516979 AAAGGGGCCAATGTAGAGTTTGG + Intergenic
970801346 4:19976597-19976619 AAAGGGGCCAATGTAAAGCTAGG - Intergenic
970868184 4:20782572-20782594 GAAAGGGCCAATGTAGAGCTTGG - Intronic
970977363 4:22057136-22057158 AAAGGGGCCAAGGTACAGCTTGG + Intergenic
970979022 4:22075242-22075264 AAAGGGGCCAATGTACAGCTTGG + Intergenic
971010655 4:22430910-22430932 AAAGGGGCCAAGGTACAGCTTGG + Intronic
971069974 4:23080253-23080275 AAAGGGGCCAAGGTACAGCTCGG - Intergenic
971224401 4:24737773-24737795 GAAGGGGCCAAGGTACAGCTTGG + Intergenic
971545477 4:27880143-27880165 AAAGGGGCCCAGGTACAGCTTGG - Intergenic
971546268 4:27891042-27891064 AAAGGGGCCAAGGTACAGCTTGG + Intergenic
971649698 4:29256602-29256624 AAAGGGGCCAAGGTAGAGCTGGG + Intergenic
971733531 4:30416834-30416856 AAAGGGGCCAAGGTACAGCTCGG + Intergenic
971739605 4:30503198-30503220 AAAGGGGCCAAGGAACAGCTTGG + Intergenic
971743602 4:30551393-30551415 AAAGGGGCCAACATAGAGCTTGG + Intergenic
971753302 4:30678263-30678285 AAAGGGGCCAACATAGAACTTGG + Intergenic
971793676 4:31199752-31199774 AAAGGGGCCAATGTAGAACTTGG - Intergenic
971857118 4:32058231-32058253 AAAGGGGCCAAGGTATAGCTTGG - Intergenic
971875313 4:32300926-32300948 AAAGGGGCCAAGGTACAGCTTGG + Intergenic
972002689 4:34058663-34058685 AAGGGGGCCAATGTACAGCTTGG - Intergenic
972054367 4:34780967-34780989 AAAGGGGCCAAGGTACAACTTGG - Intergenic
972220629 4:36950327-36950349 AAAGGGGCCAAGCTATAGCTTGG - Intergenic
972301219 4:37787380-37787402 AAAGGGGCCACCATAGAGCTTGG + Intergenic
972467497 4:39371232-39371254 AAAGGGGCCAATGTAGAGCTTGG + Intergenic
972485167 4:39533832-39533854 AAAGGGGCCAACATAGAGCTCGG + Intergenic
972744555 4:41920811-41920833 AAAGGGGCCAAGGTACAGCTTGG + Intergenic
972749350 4:41973135-41973157 AAAGGGGCCAACATAGATCTTGG + Intergenic
972799760 4:42462407-42462429 AAAGGGGCCAACATAGAGTTCGG + Intronic
972832681 4:42832781-42832803 AAAGGGGCCAAAGTACAGCTTGG + Intergenic
972844423 4:42970557-42970579 AAAGGGGACAAAATATAGCTTGG - Intronic
972993593 4:44852167-44852189 AAAGGGGCCAATGTAGAGGTTGG + Intergenic
973063890 4:45763619-45763641 AAAGGGACCAAGGTACAGCTTGG - Intergenic
973078620 4:45962162-45962184 AAAGGGGCCAACATAGCACATGG - Intergenic
973614228 4:52663086-52663108 AAAGGGGCCTACATACAGCTTGG + Intergenic
973718446 4:53700525-53700547 AAAGGGGCCAACATAGAGCTTGG - Intronic
974110878 4:57523932-57523954 AAAGGGGCCAATATAGAGCTTGG + Intergenic
974202807 4:58663030-58663052 AAAGGGGCCAGTGTAGACCTTGG - Intergenic
974215530 4:58841884-58841906 AAAAGGGTCAATGTAGAGCTCGG + Intergenic
974270990 4:59651490-59651512 AAAGGGACCAATGTACAGCTTGG + Intergenic
974455845 4:62128509-62128531 AAAGGGGCCAACATAGAATTCGG + Intergenic
974487553 4:62524846-62524868 AAAGGGGCCAACCTAGAGCTTGG + Intergenic
974494980 4:62614998-62615020 AAAGGGGCCAACATAGAGCTCGG - Intergenic
974563485 4:63553208-63553230 AAAGGGGCCAACATACCACTTGG - Intergenic
974569623 4:63628051-63628073 AAAGGGGCCAAGGTACAGTTTGG + Intergenic
974573692 4:63689020-63689042 AAAGGAGCCAAGGTACAGCTGGG + Intergenic
974679882 4:65147043-65147065 AAAGGAGCCAACATGGAGCTTGG - Intergenic
974733587 4:65900101-65900123 AAAGGGGCCAACATAGAGCTTGG + Intergenic
974748138 4:66102753-66102775 AAAGGGGCCAAGGTACAGCTTGG + Intergenic
974846040 4:67351948-67351970 AAAGGGGCCAACATACAGCTTGG - Intergenic
974897590 4:67957926-67957948 AAAGAGGCCAAGCTACAGCTTGG + Intronic
974924254 4:68277895-68277917 AAAGGTGCCAAAATACAGCTTGG + Intergenic
975040460 4:69739458-69739480 AAAGGGGCCAATGTACAGCTTGG - Intronic
975216488 4:71761723-71761745 AAAGGGGCCAATGTAGAGCTTGG + Intronic
975253994 4:72213153-72213175 AAAGGGGCCAATCTAGAGCTTGG - Intergenic
975311996 4:72913535-72913557 AAACGGGCCAACGTACAGCTTGG + Intergenic
975403323 4:73962247-73962269 AAAGGGGCCAAGGTATAGTTTGG + Intergenic
975440514 4:74405273-74405295 AAAGGGCGCATCATAGAGTTCGG + Intergenic
975542908 4:75532782-75532804 AAAGGAGCCAACATACACCTTGG - Intronic
975629012 4:76380902-76380924 AAATGGGCCAAGGTACAGCTCGG + Intronic
975729246 4:77321367-77321389 AAAGAGGCCAAGGTACAGCTTGG - Intronic
975942126 4:79660399-79660421 AAAGTGGCCAATGGAGAGCTTGG + Intergenic
976003594 4:80401442-80401464 AAAGGGGCCAATGTACAGCTTGG + Intronic
976128053 4:81854497-81854519 AAAGGGACCAAGGTACAGCTTGG - Intronic
976503149 4:85815042-85815064 AAAGGTGCCAATGTAGAGCTCGG - Intronic
976672943 4:87674040-87674062 AAAGGGGCCAAGGTACAGCTTGG - Intergenic
976674819 4:87692357-87692379 AAAGGGACCAACATAGAACTAGG + Intergenic
976875627 4:89850448-89850470 AAAGAGGCCAATGTAGAGCTTGG - Intergenic
977006077 4:91570589-91570611 AAGGGGGCCAAGGTACAGCTTGG - Intronic
977014659 4:91677870-91677892 AAAGGGGCCAACATAGAGCTTGG + Intergenic
977022188 4:91772378-91772400 AAAGGGGCCAATGTATAGCTTGG - Intergenic
977041469 4:92024569-92024591 AAAGGGGCCAAGGCACAGCTTGG - Intergenic
977063813 4:92288440-92288462 AAAGGGGCCAAGGTACAACTTGG - Intergenic
977097965 4:92769720-92769742 AAAGGGGCCAAGGTACACCTTGG - Intronic
977270949 4:94916976-94916998 AAAGGGGCCTAGGTATAGCTTGG + Intronic
977339843 4:95744328-95744350 AAAAGGGCCAATGTAGAGCTTGG + Intergenic
977393912 4:96448579-96448601 AAAGGGGCCAAGGTACAGCTTGG + Intergenic
977415971 4:96733407-96733429 AAAGGGACCAACATACAGATTGG + Intergenic
977579044 4:98704747-98704769 AAAGGGGCCAATGTAGAGCTTGG + Intergenic
977592459 4:98842058-98842080 AAAGGGGCCAACATACAGCTCGG + Intergenic
977670103 4:99685422-99685444 AAATGGGCCAAAGTACAGCTTGG + Intergenic
977704089 4:100052176-100052198 AAAGGGGCCAATGTAGAGCTTGG - Intergenic
977977723 4:103286668-103286690 AAAGGGGCTAATGTAGAGCTCGG + Intergenic
977996527 4:103502527-103502549 AAAGGGGTCAATGTAGAGCTTGG + Intergenic
978101093 4:104841501-104841523 AAAGGGGCCAACGTACAGCTTGG - Intergenic
978103877 4:104877175-104877197 AAAGGAGACACCAGAGAGCTTGG + Intergenic
978153406 4:105463724-105463746 AAAGGGGCCAAGGTACAGCTTGG + Intronic
978201567 4:106028887-106028909 AAATGGGCCAAGGTACAGCTTGG + Intergenic
978265868 4:106823428-106823450 AAAAAGACCAACATACAGCTTGG - Intergenic
978374662 4:108062193-108062215 AAAGGGGCCAGCAGAGATTTTGG - Intronic
978579555 4:110218396-110218418 AAAAAGGCCAACATATAGCTTGG - Intergenic
978591565 4:110329791-110329813 AAAGGGGCCAAGGTACACCTTGG + Intergenic
978856539 4:113400762-113400784 AAAGGGGCCAAGGTACAGCTCGG + Intergenic
979063530 4:116098276-116098298 AAAGGGGACAACAAAGAGCTAGG + Intergenic
979079175 4:116312340-116312362 AAAGGGGCCAAGACACAGCTTGG - Intergenic
979097860 4:116573726-116573748 AAAGGTGCCAACATAGAGCTTGG - Intergenic
979116102 4:116826560-116826582 AAAGGAGCCAAGAGACAGCTTGG - Intergenic
979137494 4:117127929-117127951 AAAGGGGCCAAGGTACAGCTTGG + Intergenic
979356504 4:119712175-119712197 AAAGGGACCAAGATGCAGCTTGG + Intergenic
979368030 4:119848420-119848442 AAAGGGGCCAATGTAGAGCTTGG - Intergenic
979426428 4:120572671-120572693 AAAGGGGCCAAGGTACAGGTTGG - Intergenic
979645283 4:123060537-123060559 AAAGGGGTCAAGGTACAGCTTGG - Intronic
979775238 4:124581886-124581908 AAAAGGGCCAAGGTACAGCTTGG - Intergenic
979805147 4:124961478-124961500 AAAGGGGCAAAGGTACAGCTTGG - Intergenic
979824909 4:125220954-125220976 AAAGGGGCCAAGGTACAGCTTGG + Intergenic
979856205 4:125637310-125637332 AAAGGGGCCAAGGTACAACTTGG - Intergenic
979923022 4:126524844-126524866 AAAGAGGCCAATATAGAGTTCGG - Intergenic
979974897 4:127184598-127184620 AAAGGGGCCATGGTACAGCTTGG + Intergenic
979984394 4:127296029-127296051 AAAGGGGCCAAGGTTCAGCTTGG - Intergenic
980065734 4:128186882-128186904 AAAGGGGCCCAGATACAGCTTGG + Intronic
980083621 4:128369331-128369353 AAAGGGGCCAATGTACAGTTCGG - Intergenic
980090819 4:128441272-128441294 AAATGGGCCAATGTACAGCTCGG - Intergenic
980202765 4:129677200-129677222 AAAGGGGCCAACATACAGCTTGG + Intergenic
980248104 4:130274082-130274104 GAAGGAGCCAACATGGATCTGGG + Intergenic
980266545 4:130524144-130524166 AAAGGGGCCAAGGTACAGCTTGG - Intergenic
980280095 4:130707603-130707625 AAAGGGGCCAAGGTACAACTTGG - Intergenic
980292434 4:130860344-130860366 AAAAGGGCCAACTTGGAGCTTGG + Intergenic
980324460 4:131323973-131323995 AAAGGGGCCAAGGTACAGCTTGG + Intergenic
980350693 4:131680357-131680379 AAAGGGACCAAGGTACAGCTTGG + Intergenic
980391746 4:132156060-132156082 AAAGGGGCCAAGTTACAGCTTGG - Intergenic
980430177 4:132684056-132684078 AAAGGGGCCAAAGTACAGCTTGG - Intergenic
980494954 4:133578240-133578262 AAAAGGGCCAAGGTACAGCTAGG + Intergenic
980641410 4:135585316-135585338 AAATGGGCCAAGGTACAGCTCGG + Intergenic
980646098 4:135644124-135644146 AAAGGGGCCACTGTACAGCTTGG + Intergenic
980720419 4:136687630-136687652 AAAGGGGCCAACATAGAGCTTGG - Intergenic
981121017 4:141051126-141051148 AAAGGGGCCAAGGTACAGCTTGG - Intronic
981281693 4:142966328-142966350 AAAGGGGCCAACATACAGCTCGG - Intergenic
981356886 4:143799283-143799305 AAAGGGGCCAAGGTACAGTTTGG - Intergenic
981368416 4:143929880-143929902 AAAGGGGCCAAGGTACAGTTTGG - Intergenic
981370373 4:143952572-143952594 AAAGGGGCCAAGGTAGAGTTCGG + Intergenic
981378214 4:144040165-144040187 AAAGGGGCCAAGGTACAGTTTGG - Intergenic
981503119 4:145473564-145473586 AAAGGAGCCAAGATACAGCTTGG - Intergenic
981862885 4:149378988-149379010 AAAGGGGCCAAAGTACAGCTTGG + Intergenic
982019638 4:151190550-151190572 AAAGGGGACAACGTAGAGCTTGG + Intronic
982075994 4:151737759-151737781 AAAGGGGCAAAGGTACAGCTTGG + Intronic
982121271 4:152145718-152145740 AAAGGAGTCAATATAGAGCTTGG - Intergenic
982192923 4:152876833-152876855 AAAGGGGCCAATGTAGAGCTTGG + Intronic
982279124 4:153665976-153665998 AAAGGAGCCAAGGTACAGCTTGG + Intergenic
982299870 4:153867663-153867685 AAAGGGGCCAAGGTGCAGCTTGG + Intergenic
982521017 4:156416792-156416814 AAAGGGGCCACGGTATAGCTTGG - Intergenic
982524990 4:156466919-156466941 AAAGAGGCCAAGGTACAGCTTGG - Intergenic
982618912 4:157678603-157678625 AAAGGGGCCAATGTAGAGCTTGG - Intergenic
982730754 4:158953300-158953322 AAAGGGGCCAACATAGAGCTTGG + Intronic
982948915 4:161663976-161663998 AAAGGGGCCAATGTACAGCTTGG - Intronic
982966351 4:161913405-161913427 AAAGGGGCCAAGATACAGCTTGG + Intronic
983075194 4:163317154-163317176 AAAGGGGCCCATGTATAGCTTGG - Intergenic
983089543 4:163487380-163487402 AAAGGGGCCAAGGTAGAGTTTGG - Intergenic
983105633 4:163682576-163682598 AAAGGGGCCAAGGTACAGCTTGG + Intronic
983657523 4:170098307-170098329 AAAGGAGCCAAAGTACAGCTCGG - Intergenic
983660437 4:170126126-170126148 AAAGGGGCCAATGTAGAGTTTGG + Intergenic
983812319 4:172077964-172077986 AAAGGGACCAAGGTACAGCTTGG + Intronic
983874738 4:172862977-172862999 AAAGGGGCCAAGGTACAGCTTGG + Intronic
983968513 4:173843609-173843631 AAAGGGGCCAAGGTACAGCTTGG + Intergenic
984047231 4:174815665-174815687 AAATGGGCCAAGGTACAGCTTGG - Intronic
984232111 4:177112153-177112175 AAAGGGGCCAATGTGGAGCTTGG - Intergenic
984234710 4:177142167-177142189 AAAGGGGCTAGTGTAGAGCTTGG + Intergenic
984386123 4:179060077-179060099 AAAGGGCCCAGCATAGATCCTGG - Intergenic
984415973 4:179459042-179459064 AAAGAGGCCAACATAGAGCTTGG + Intergenic
984454268 4:179945144-179945166 AAAGGGGCCAAGGTACAACTGGG + Intergenic
984455369 4:179959848-179959870 AAAGGGGCGAACATTGAACTGGG + Intergenic
984553319 4:181185572-181185594 AACGGGGCCAAGGTACAGCTTGG - Intergenic
984774261 4:183467026-183467048 AAAGGGGCGAACACACAGCTCGG + Intergenic
985304296 4:188521934-188521956 AAAGGGGCCAAGGTACAGCTTGG + Intergenic
985617069 5:929453-929475 AAAGGGGCCAAGGTACAACTTGG + Intergenic
985617783 5:934470-934492 AAAGGGGCCAAGGTACAACTTGG - Intergenic
986014663 5:3747523-3747545 AAAGGGGCCAGGGTACAGCTTGG + Intergenic
986016574 5:3762673-3762695 GAAGAAGCCAACACAGAGCTGGG - Intergenic
986105524 5:4656031-4656053 AAAGGGGCCACTGTAGTGCTGGG - Intergenic
986113948 5:4750721-4750743 AAATGGGCCAATATAGAGCTTGG - Intergenic
986455316 5:7912435-7912457 AAAGAGGCCAAGGTACAGCTTGG - Intergenic
986601543 5:9478056-9478078 ATAGGGGCCAAGGTACAGCTTGG + Intronic
986680116 5:10224705-10224727 AAACGGGCCAAGGTACAGCTCGG - Intergenic
986756772 5:10844060-10844082 AAAGGGGCCAACGTACAGCTTGG - Intergenic
986869248 5:12028052-12028074 AAAGCGGCCAAGGTACAGCTTGG - Intergenic
986873440 5:12078718-12078740 AAAGGGGTCAATGTAGGGCTAGG - Intergenic
986911627 5:12565017-12565039 AAAGAGGCCAATATAGAGCATGG - Intergenic
986960355 5:13203045-13203067 AAAGGGGCCAATGTAGAGCTCGG - Intergenic
987097944 5:14566535-14566557 AAAGGGGCCAAGGTACAGCTCGG - Intergenic
987225938 5:15841750-15841772 AAAGGGGCCAATGTAAGGCTGGG + Intronic
987289539 5:16495546-16495568 AAAGAGGCCAAGGTACAGCTCGG + Intronic
987435237 5:17885635-17885657 AAAGGGGCCAAGGTACAGCTTGG + Intergenic
987455396 5:18138577-18138599 AAAGGGACCAAGGTATAGCTTGG - Intergenic
987464204 5:18252836-18252858 AAAGGAGCTAATGTAGAGCTGGG + Intergenic
987482795 5:18479930-18479952 AGAGGGGCCACCATATGGCTGGG - Intergenic
987494876 5:18630530-18630552 AAAGGGGCCAAGATACAGCTTGG - Intergenic
987562400 5:19540694-19540716 AAAAGGGCCAAGGTATAGCTTGG - Intronic
987602096 5:20084775-20084797 AAAGGGGCCAACATAGAGCTTGG - Intronic
987610663 5:20198848-20198870 AAAGGGGCCAAGGTATAGCCTGG + Intronic
987655448 5:20800278-20800300 AAAGGGGTCAACATAGAGCTTGG + Intergenic
987723105 5:21663675-21663697 AAAGGGGCCAACATAGAGCTGGG - Intergenic
987773570 5:22336560-22336582 AAAGTGGCCAAGGTACAGCTTGG + Intronic
987792111 5:22581313-22581335 AAAGGGGCCAATATAGAGCTTGG + Intronic
987810387 5:22827162-22827184 AAATGGGCCAATGTAGAGCTCGG + Intronic
987894358 5:23925701-23925723 AAAGGGGCCAATGTACAGCATGG - Intergenic
987984882 5:25133947-25133969 AAAGGGGCCAAGTTACAGCTTGG + Intergenic
988047712 5:25979944-25979966 AAAGGGGCCAAGGTAAAGTTTGG - Intergenic
988080651 5:26410712-26410734 AAAGGAGCCAAGGTACAGCTTGG + Intergenic
988091105 5:26542359-26542381 AAAGGGGACAAGGTACAGCTTGG - Intergenic
988103145 5:26708231-26708253 AAAGGGGCCAAGGTAAATCTCGG + Intergenic
988134862 5:27157971-27157993 AAAGGGGACAAAATACAGCTTGG + Intergenic
988199937 5:28054808-28054830 AAAGGGGCCAACATAGAGCTCGG - Intergenic
988204396 5:28115483-28115505 AAAGGGGCCAATGAAGAGCTAGG - Intergenic
988221246 5:28349324-28349346 AAAGGGGTCAATGTAGAGCTCGG - Intergenic
988227075 5:28426390-28426412 AAAGGGACCAATGTATAGCTTGG + Intergenic
988316993 5:29643878-29643900 AAAGGTGCCAATGTAGAGCTTGG + Intergenic
988319112 5:29669828-29669850 AAAGGGGCCAAAGTACAGCTTGG + Intergenic
988394425 5:30679212-30679234 AAAGGGGTCAAGGTACAGCTTGG + Intergenic
988426867 5:31074419-31074441 AAAGGGGCCAAAGTACAGCTTGG - Intergenic
988471940 5:31547666-31547688 AAAGGGGCCAACATAGAGCTCGG - Intronic
988649402 5:33131752-33131774 AAGGGGTCCAATGTAGAGCTTGG + Intergenic
988740119 5:34061658-34061680 AAAGGTGCCAACATAGAGCTGGG - Intronic
988764099 5:34350758-34350780 AAAAGGGGCAACATACAGCTTGG - Intergenic
988768109 5:34403624-34403646 AAAGGGGTCAACATAGAGCTTGG - Intergenic
988770458 5:34427676-34427698 AAAGGGGCCAAGCTACGGCTTGG - Intergenic
988804486 5:34727637-34727659 AAAGGGGCCAAGGTACAGCTTGG + Intronic
988808899 5:34765938-34765960 AAAGGGGCCAACATAGAACTTGG + Intronic
988886070 5:35559247-35559269 AAATGGGCCAAGGTACAGCTTGG - Intergenic
989032823 5:37136798-37136820 GAAGGCGCCAAGATACAGCTTGG - Intronic
989047015 5:37283332-37283354 AAAGGGGCCAAAGTACAGCTTGG - Intergenic
989389175 5:40882564-40882586 AAAGGGGTCAACGTACAGCTTGG + Intergenic
989651623 5:43696800-43696822 AAAGGGGCCAAGGTATAGCTTGG - Intronic
989726873 5:44597475-44597497 AAAGGGGCCAAGGTACAGCTTGG - Intergenic
989746818 5:44839305-44839327 AAAGGGGCCAAGGTATAGCTTGG + Intergenic
990021122 5:51128532-51128554 AAAAGGGCCAAGGTACAGCTTGG + Intergenic
990136015 5:52645043-52645065 AAAGGGGCCAAAGTACAGCTGGG + Intergenic
990143358 5:52731037-52731059 AAAGGGACCAAGGTACAGCTTGG + Intergenic
990193318 5:53286432-53286454 AAAGGGTCCAACATAGAGCTTGG - Intergenic
990526064 5:56628924-56628946 AAAGGGGTCAACATAGAGCTCGG + Intergenic
990595534 5:57309308-57309330 AAAGGGGCCAATATAGAGCTTGG + Intergenic
990701082 5:58475510-58475532 AAAGGTGCCAAGGTACAGCTTGG - Intergenic
990883771 5:60569009-60569031 AAAGGGGCCAAGGTATAGCTTGG - Intergenic
991104943 5:62833033-62833055 AAAGGGGCCAACATAGAGCTCGG - Intergenic
991116869 5:62964516-62964538 AAAGGGGCCAAGGTACAGCTTGG - Intergenic
991340336 5:65601841-65601863 AAAGGGGCCAATGTAGAGCTCGG - Intronic
991535896 5:67669158-67669180 AAAGCGGCCAAGGTACAGCTTGG + Intergenic
991586918 5:68211018-68211040 AATGGGGCCAAGGTACAGCTTGG - Intergenic
991616011 5:68497932-68497954 AAAGGGGCCACTGTAGAGCTTGG + Intergenic
991776340 5:70089406-70089428 AAAGGGGCCTAGGTACAGCTTGG + Intergenic
991855627 5:70964853-70964875 AAAGGGGCCTAGGTACAGCTTGG + Intergenic
991869639 5:71097631-71097653 AAAGGGGCCTAGGTACAGCTTGG + Intergenic
992138079 5:73767972-73767994 AAAGGAACCAACACAGAACTCGG + Intronic
992279685 5:75161788-75161810 AAAGGGACCTATGTAGAGCTTGG + Intronic
992651567 5:78865349-78865371 AAAGGGGCCAATGTAGAGCTTGG - Intronic
992954187 5:81890893-81890915 AAAGGGGCCAAGGTACAGTTTGG + Intergenic
992969643 5:82043248-82043270 AAAGGGGCCATGGTACAGCTAGG - Intronic
993000972 5:82380030-82380052 AAAGGGGCCAATGTAGCACTTGG - Intronic
993015680 5:82532175-82532197 AAATGGGCCAAGGTACAGCTTGG - Intergenic
993084610 5:83348472-83348494 AAAGGGGCCAACATGCAGCTTGG - Intronic
993200794 5:84812776-84812798 AAAGGGGCCAAGTTACAGCTGGG + Intergenic
993235516 5:85303384-85303406 AATGGGGCCCAAATAGAGATTGG - Intergenic
993260713 5:85655193-85655215 AAAGGGGCCAATGTAGAGTTAGG + Intergenic
993267110 5:85740273-85740295 AAAGGGGCCAAGGTACAGCTTGG - Intergenic
993293791 5:86109014-86109036 AAAGGGGCCAATGTAGAGCCTGG + Intergenic
993309680 5:86313793-86313815 AAAGGGGCCAACATACAGCTTGG + Intergenic
993391003 5:87319544-87319566 AAAGGGGCCAATGTACAACTCGG - Intronic
993409376 5:87554837-87554859 AAAGGGGCCAAGGCACAGCTTGG - Intergenic
993451269 5:88074322-88074344 AAAGGGGCCAAGGTACAGCATGG + Intergenic
993575134 5:89591080-89591102 AAAGGGGTCAAGGTACAGCTAGG + Intergenic
993723992 5:91347944-91347966 AAAGGGGCCAACATAGAGCTCGG - Intergenic
993801772 5:92351476-92351498 AAAGGGGCCAACATAGAATTTGG + Intergenic
993893723 5:93505670-93505692 AAAGGGGCCAATGTAAAGCTTGG - Intergenic
994018966 5:95002038-95002060 CAAGGGGCCAAGGTACAGCTTGG + Intronic
994234264 5:97342941-97342963 AAAGGGGCCAAGGTATAGTTTGG - Intergenic
994375177 5:99010396-99010418 AAAGGGCCCCAAATACAGCTCGG - Intergenic
994440815 5:99800685-99800707 AAAGGGGCCAAAATACAGCTCGG - Intergenic
994548709 5:101204921-101204943 AAAGGGACCAAGGTAGAGCTTGG + Intergenic
994614939 5:102092498-102092520 AAAGGGGCTAACATAGAGCTTGG - Intergenic
994637701 5:102363502-102363524 AAAAGGGCCAAGGTATAGCTTGG - Intergenic
994689546 5:102999751-102999773 AAAGAGGCCAAGGTATAGCTTGG - Intronic
994749564 5:103721306-103721328 AAAGGCGCCAAGGTACAGCTTGG - Intergenic
994755646 5:103790556-103790578 AAAAGGGCCAACATAGAGCTTGG - Intergenic
994764521 5:103900029-103900051 AAAGGGGCCAATGTATAGCTCGG + Intergenic
994813751 5:104557059-104557081 AAAGGAGCCAAGGTAAAGCTTGG - Intergenic
994895617 5:105698220-105698242 AAAGTGGCCAACGTAGAGCTTGG - Intergenic
994900444 5:105762837-105762859 AAAGGGGCCAAAATAGAGCTTGG - Intergenic
994920097 5:106032171-106032193 AAAGGAGCCAACGTACAGCTTGG - Intergenic
995113495 5:108453855-108453877 AAAGGGGCCAAGGTACAGCTTGG + Intergenic
995147753 5:108806134-108806156 AAAGGGGCCAAGGTATAGCTTGG + Intronic
995220360 5:109641258-109641280 AAAGGGGAAAATGTAGAGCTTGG + Intergenic
995312709 5:110731616-110731638 AAAGGGGCCAGTGTAGAGCTTGG - Intronic
995390967 5:111639931-111639953 AAAGGGGCAAAGGTAGAGCCTGG + Intergenic
995392430 5:111653557-111653579 GAAAGGGCCAACATACAGCTTGG - Intergenic
995701352 5:114939127-114939149 AAAGGGGCCAAGGCACAGCTTGG + Intergenic
995779819 5:115763035-115763057 AAAAGGGCCAAGATACAGCTTGG - Intergenic
995925531 5:117369296-117369318 AAAGGAGCCAAGGTACAGCTTGG + Intergenic
996033588 5:118733689-118733711 AAAGAAGCAAACATAGAGCATGG + Intergenic
996222803 5:120953736-120953758 AAAGGGGCCAACATGCAGCTTGG + Intergenic
996236912 5:121141676-121141698 AAAGGGGCCAAGGTACAGCTTGG - Intergenic
996247529 5:121282866-121282888 AAAGAGGTCAAGGTAGAGCTCGG + Intergenic
996356467 5:122601004-122601026 AAAGGGGTCAAGATACAGCTTGG - Intergenic
996460165 5:123732552-123732574 AAAGGGGCCAATGTAGAACTTGG + Intergenic
996487383 5:124052815-124052837 AATGGAACCAACATAGAGCAAGG + Intergenic
996526882 5:124489319-124489341 AAAGGGACCAATGTACAGCTTGG - Intergenic
996670587 5:126113126-126113148 AAAGGGGCCAATGTACAGCTTGG + Intergenic
996701044 5:126450723-126450745 AAAGGGGCCCAGGTACAGCTCGG + Intronic
996967313 5:129321308-129321330 AAAGGGGCAAAGGTAGAGATTGG - Intergenic
997016234 5:129938157-129938179 AAAGGGACCAACGTACAGCTTGG - Intronic
997022061 5:130013592-130013614 AAAGGGACCAAGGTACAGCTGGG - Intronic
997036855 5:130202953-130202975 AAAGGTGCCAACGTACAGCTTGG - Intergenic
997056682 5:130452232-130452254 AAAGGGGCCAACATACACCTTGG - Intergenic
997086456 5:130806034-130806056 AAAGGGGCCAAGGTACAGCTTGG + Intergenic
997102092 5:130980640-130980662 AAAGGGGCCAAGGTACAGCTTGG - Intergenic
997116125 5:131127381-131127403 AAAGGGGCCAACATAGAGCTTGG + Intergenic
997181430 5:131832794-131832816 AAAGGGGTGAACGCAGAGCTTGG - Intronic
997492037 5:134285451-134285473 AAGGGGGCCAATGTAGAGCTTGG - Intergenic
997692845 5:135838658-135838680 AAAGGGGCCAAGGTACAGCTTGG + Intronic
998144648 5:139720244-139720266 AAAGGGGCCAATATACAGCATGG + Intergenic
998722969 5:144975426-144975448 AAAGGGGCCAATGTAGAGCTTGG + Intergenic
998759050 5:145411936-145411958 AAAGGGGCCAAGGTACAGCTCGG - Intergenic
998813951 5:145993626-145993648 AAAGGAGCCAATATAGAGTTTGG - Intronic
998889333 5:146729661-146729683 AAAAGGGCCAACATACAGCTTGG + Intronic
999346112 5:150820835-150820857 AAAGGGGCCAATATACAGCTCGG - Intergenic
999541067 5:152573066-152573088 AAAGGGGCCAAAATATAGCTTGG + Intergenic
999919758 5:156305339-156305361 AAAGGGGCCAACATAGAGCTTGG + Intronic
1000030507 5:157397328-157397350 AAAGGGGCCAATGTAGAGCTCGG - Intronic
1000226514 5:159266767-159266789 AAAGGGGCCAACTTACAGCTTGG + Intronic
1000270636 5:159680122-159680144 AAAGGGGCCAAGGTACAGCTTGG + Intergenic
1000442474 5:161280294-161280316 AAAGAGGCCAATGCAGAGCTTGG - Intergenic
1000496366 5:161989803-161989825 AAAGGGGCCAAGGTACAGCTTGG - Intergenic
1000564916 5:162835057-162835079 AAAGGGGCGAAAGTACAGCTTGG - Intergenic
1000648450 5:163785869-163785891 AAAGAGGCCAATGTACAGCTTGG - Intergenic
1000728520 5:164802026-164802048 AAAGGGGCCAAGGTACACCTCGG - Intergenic
1000751123 5:165097697-165097719 AAAGGGGTCAACATAGAGCCTGG - Intergenic
1000777891 5:165442284-165442306 AAAGGGGCCGAGGTACAGCTTGG - Intergenic
1001191281 5:169634083-169634105 CAAGGGGCCAACATCCAGCAAGG - Intergenic
1001611225 5:173003709-173003731 AAATGGCCCAACCTAGAACTGGG - Intronic
1001944445 5:175767048-175767070 AAAGGGCCCCAGATACAGCTTGG - Intergenic
1002794045 6:456505-456527 AAAGGGGCCCAGGTATAGCTTGG - Intergenic
1003051904 6:2787917-2787939 AGAGGGGCCCAGATAGAGCCAGG - Intergenic
1003230050 6:4243638-4243660 AAAGGGGCCAAGGTACAGCTTGG - Intergenic
1003259797 6:4506811-4506833 AAAGGGGCCAAGGTACAACTTGG - Intergenic
1003360569 6:5421228-5421250 AAAGGGGTCAATGTAGAGCTCGG - Intronic
1003659288 6:8045184-8045206 AAAGGGGCCGACATACAGCTTGG + Intronic
1003690184 6:8346326-8346348 AAAGGGGCCAAGGTACAGCTTGG + Intergenic
1003720135 6:8692702-8692724 AAAGGGGCCAACATACAGCTCGG + Intergenic
1004430214 6:15536446-15536468 AAAGGGGCCAAGGTACAGCTTGG + Intronic
1004830861 6:19475426-19475448 AAAGGGGCCAAGGAACAGCTTGG - Intergenic
1005548628 6:26894362-26894384 AAAGGGGCCAAGGTACACCTCGG + Intergenic
1005655282 6:27929231-27929253 AAAGGGGCCAATGTACAGCTTGG - Intergenic
1005921705 6:30407510-30407532 AAAGGGGCCAAGGTACAGCTTGG + Intergenic
1005984149 6:30860068-30860090 AAAGGGGCCAAGGTACAGCTTGG - Intergenic
1006344141 6:33466358-33466380 AAAGGGGCCAATGTACAGCTTGG + Intergenic
1006693238 6:35908817-35908839 AAAGGGGCTAAGGTACAGCTTGG + Intronic
1006697121 6:35940667-35940689 AAAGGGGCCAACATAGAGCTCGG + Intergenic
1007021477 6:38526216-38526238 AAAGTGGCCAAGGTACAGCTTGG + Intronic
1007185897 6:39972155-39972177 AAAGGGGCCAATGTAGAGCTTGG + Intergenic
1007889283 6:45271419-45271441 AAAGAGGCCAAGGTATAGCTCGG + Intronic
1008104680 6:47428866-47428888 AAAGGGGCCCAGGTACAGCTTGG - Intergenic
1008199140 6:48564712-48564734 AAAGGTCCCCACATATAGCTTGG + Intergenic
1008242225 6:49127514-49127536 AAAGGGGCCAAGCTACAGCTTGG + Intergenic
1008631474 6:53366324-53366346 CAAGGGGCCAAGGTACAGCTTGG - Intergenic
1008681475 6:53877187-53877209 AAAGGGGCCAAAGTATAGCTTGG - Intronic
1008756120 6:54797203-54797225 AAAGGGGCCAACATAGAGCTTGG + Intergenic
1009289509 6:61866370-61866392 AAAGGGGCCGACATAGAGCTCGG - Intronic
1009309630 6:62134260-62134282 AAAGAGGCCAAGGTACAGCTTGG + Intronic
1009346084 6:62614236-62614258 AATGGAGCAAACATAGAGCTAGG + Intergenic
1009348455 6:62646203-62646225 AAAGGGGCCAAGGTGCAGCTTGG + Intergenic
1009396277 6:63203904-63203926 AAAGGGGCCAATGTAGAGGGTGG - Intergenic
1009480975 6:64157635-64157657 AAAGGGGCTAACATAGAGCTTGG + Intronic
1009490529 6:64284809-64284831 AAAGAGGCCAACACAGAGCTTGG - Intronic
1009554774 6:65148898-65148920 AAAGGGGCCAAGGTACAGCTTGG - Intronic
1009769156 6:68122153-68122175 AAAGGGGCCAAATTATAGCTTGG - Intergenic
1009772463 6:68161033-68161055 AAAGGGGCCAATGTAGAGCTCGG + Intergenic
1009780322 6:68260606-68260628 AAAGAGGCCAATGTAGAGCTTGG - Intergenic
1009791224 6:68403779-68403801 AAAGGGGCCAAGGTATAGTTTGG - Intergenic
1009792368 6:68419974-68419996 AAAGGGGCCAAGGTACAGCTTGG + Intergenic
1009816984 6:68748977-68748999 AAAGGGGCCAATGTACAGCTTGG - Intronic
1010005522 6:70991533-70991555 AAAGGGGCCAAGGTACAGCCTGG + Intergenic
1010248363 6:73682868-73682890 AAAGGGGCCAATGTAGAGCTCGG - Intergenic
1010324105 6:74545008-74545030 AAAGGGGCCAAGGTACAGCTTGG - Intergenic
1010458217 6:76083007-76083029 AAAGTGGCCAAGGTAAAGCTTGG - Intergenic
1010594600 6:77748423-77748445 AAAGGGGCCACAGTAAAGCTTGG - Intronic
1010810430 6:80293403-80293425 AAAGGGGCCAAGGCACAGCTTGG - Intronic
1010835818 6:80586522-80586544 AAAGGGGCTAAGGTACAGCTTGG + Intergenic
1010882933 6:81201775-81201797 AAAGGGGCCAAGGTACAGGTTGG + Intergenic
1010898193 6:81392359-81392381 AAAGGGGCCAAGGTACACCTTGG + Intergenic
1010900537 6:81422687-81422709 GAAGGGGCCAAGGTACAGCTTGG + Intergenic
1010909558 6:81536678-81536700 AAAGGGGCCAAGGTACAGCTCGG - Intronic
1011011201 6:82705691-82705713 AAAGGGGCAAAGGTACAGCTTGG - Intergenic
1011041137 6:83031830-83031852 AAAGGGGCCAAGGTACAGCTCGG + Intronic
1011088607 6:83570656-83570678 AAAGGGGCCAAGGGACAGCTTGG + Intronic
1011136240 6:84104178-84104200 AAAGTGGCCAATGTAGAGCTCGG - Intergenic
1011152540 6:84290168-84290190 AAAGGGGCCAATGTAGAGCTCGG - Intergenic
1011170932 6:84503792-84503814 AAACAGGCCAATGTAGAGCTGGG + Intergenic
1011461973 6:87614237-87614259 AAAAGGGCCAACACAAAGTTCGG - Intronic
1011738278 6:90334050-90334072 AAAGGGGCCAAGGCACAGCTTGG - Intergenic
1011835058 6:91421382-91421404 AAAGGGGCCAACAAAGAGCTTGG + Intergenic
1011845021 6:91552430-91552452 AAAGAGGCCAAGATATGGCTTGG - Intergenic
1011942309 6:92857550-92857572 AAAGGGGCCAAGATACAGTTTGG - Intergenic
1011962355 6:93106625-93106647 AGTAGGGCCAACATAGAGTTGGG + Intergenic
1012148706 6:95718625-95718647 AAAAGGGCCAACATAGAATCAGG - Intergenic
1012161348 6:95888870-95888892 AAAGGGGCCAAGGTACAGCTTGG - Intergenic
1012196015 6:96342152-96342174 AAAGGGGCCAACATAGAGCTCGG - Intergenic
1012202549 6:96424288-96424310 AAAGGGACCAAGGTACAGCTTGG - Intergenic
1012239913 6:96860100-96860122 AAAGGGGCGAATGTAGAGCTTGG + Intergenic
1012342406 6:98143234-98143256 AAAGGGGCCAAGGTACAGTTTGG - Intergenic
1012380638 6:98615766-98615788 ACAGGGGCCAAGGTACAGCTTGG - Intergenic
1012478223 6:99637719-99637741 AAAGGGGCCAACGTACAGCTTGG - Intergenic
1012485885 6:99722338-99722360 AAAGGGGCCAAGGTACAGCTTGG + Intergenic
1012617379 6:101293527-101293549 AAAGGGGCCAAGGTACAGCTTGG - Intergenic
1012690775 6:102308286-102308308 CAACAAGCCAACATAGAGCTTGG - Intergenic
1012811678 6:103967003-103967025 AAAGGGGCCAAGGTACAGCTAGG - Intergenic
1012826380 6:104151735-104151757 AAAGGGTCCAACAAACAGCTTGG - Intergenic
1013077000 6:106780646-106780668 AAAGGGGCCAATGTACAGCTCGG + Intergenic
1013086633 6:106863132-106863154 AAAGGGGCCAACATAGGGCTTGG + Intergenic
1013213691 6:108008446-108008468 AAAGGGGCCAAGGTATAACTTGG - Intergenic
1013688074 6:112609203-112609225 AAAGGGTTCAAGATACAGCTTGG + Intergenic
1013829563 6:114255747-114255769 AAAGAGGCCAAGGTACAGCTTGG - Intronic
1013904445 6:115198631-115198653 AAAGGGGCCAACATACAGCTCGG - Intergenic
1014101644 6:117517748-117517770 GAAGGGGACAACGTAGAACTCGG - Intronic
1014133993 6:117866663-117866685 AAAGGGGCCAACATATAGCTCGG - Intergenic
1014374792 6:120659325-120659347 AAAGGGTCCAAGGTACAGCTTGG - Intergenic
1014449350 6:121565427-121565449 AAAGGGGCCAACATAGAGCTTGG + Intergenic
1014482464 6:121954946-121954968 AAAGGGGCCAAGGTACAGCTTGG - Intergenic
1014621714 6:123675077-123675099 TAAGGGGCCAACGTATGGCTTGG - Intergenic
1014670722 6:124301176-124301198 AAAGGGGCCAAGGTACAGCTCGG + Intronic
1014730978 6:125031090-125031112 AAAGAGGCCAACATACAGCTCGG - Intronic
1014790137 6:125663288-125663310 AAAGGGGCTTACCTAAAGCTGGG - Intergenic
1014863257 6:126496719-126496741 AAAGGGGACAACCTACAGCCTGG - Intergenic
1015039837 6:128703611-128703633 AAAGGAGCCAAGGTACAGCTTGG + Intergenic
1015110728 6:129588927-129588949 AAAGGGGCCAAGGTACAGCTCGG - Intronic
1015178607 6:130338164-130338186 AAAAGGGCCATGATACAGCTTGG + Intronic
1015351534 6:132225504-132225526 AAAGGGGCCAAGGTACAGCTTGG + Intergenic
1015523165 6:134151561-134151583 AAAGGGGCCAATGTACAGATAGG + Intergenic
1015969628 6:138730930-138730952 AAAGGGGCCAACATAGAGTTTGG - Intergenic
1016108162 6:140188442-140188464 AAAGGGGCCAACATAGAGCTTGG + Intergenic
1016143656 6:140644011-140644033 AAAGGGGCCGAGGTACAGCTGGG - Intergenic
1016175220 6:141071577-141071599 AAAGGGGCAAAGGTACAGCTCGG + Intergenic
1016187959 6:141221323-141221345 AAAGGGGCCATGGTACAGCTTGG - Intergenic
1016209004 6:141505544-141505566 AAAAGGGCCAAGGTATAGCTTGG - Intergenic
1016244605 6:141967220-141967242 AAAGTGGCCAAGGTATAGCTGGG - Intergenic
1016411190 6:143785796-143785818 AAAGGGGCAAATGTAGAACTTGG - Intronic
1016537614 6:145126270-145126292 AAAGCGGCCAAGGTACAGCTTGG + Intergenic
1016621024 6:146109339-146109361 AAAGGGGCCAAGGCACAGCTTGG + Intronic
1016785875 6:148010526-148010548 AAAGGGGCCAAGGTACAACTTGG + Intergenic
1017547561 6:155468393-155468415 AAAGGGGCCAACCTACAGCTTGG - Intergenic
1017614867 6:156235407-156235429 AAAGAGGCCAAGATAGATCCAGG - Intergenic
1017640653 6:156490700-156490722 AAAGGTGCCAAGGTACAGCTCGG + Intergenic
1018040989 6:159922078-159922100 AAAGGGGCCAACATAGAGCTTGG + Intergenic
1018511123 6:164526024-164526046 AAAAGGGCCAAGGTACAGCTCGG + Intergenic
1018554558 6:165036328-165036350 AAAGGGGCCAACACAGAGCTCGG + Intergenic
1018721559 6:166577002-166577024 AAAGGGGCCAAGGTACAGCTCGG + Intronic
1020388299 7:7631803-7631825 AAAGGGGCCAAGGTATAGCTTGG + Intergenic
1020455970 7:8374178-8374200 AAAGGGGCCCATGTAGAGCTTGG + Intergenic
1020537879 7:9424398-9424420 ACAGGGGGCAACACAGATCTTGG - Intergenic
1020611314 7:10401383-10401405 AATGGGGCCAAGGTACAGCTCGG - Intergenic
1020631862 7:10649570-10649592 AAAGGGGCCAACATAGAGCTTGG - Intergenic
1020731563 7:11887727-11887749 AAAGGGGCCAAAATAGAGCTCGG + Intergenic
1020731994 7:11892317-11892339 AAAGGGACCCATATATAGCTTGG + Intergenic
1020780893 7:12516226-12516248 TAAGGGGCCAATGTAGAGCTTGG + Intergenic
1020869290 7:13607565-13607587 AAAGGGGCCAAGTTATAGCTCGG + Intergenic
1021036855 7:15810056-15810078 AAAGGGGCCAAAGTAGAGCTAGG - Intergenic
1021192976 7:17643683-17643705 AAAGGGGCCAACGTAGAGCTTGG + Intergenic
1021529826 7:21632121-21632143 AAAGGGGCCAACATAGAGCTCGG - Intronic
1021754015 7:23833689-23833711 AAAGGGTCCAAGGTACAGCTCGG + Intergenic
1021991367 7:26144486-26144508 AAAGGGGCCAGCGCAGAGCAGGG + Intergenic
1022397181 7:29999893-29999915 AAAGGGGCCAATGTAGAGCTCGG - Intergenic
1022549692 7:31227269-31227291 AAAGGGGCCAATGTACAGCTTGG + Intergenic
1022907662 7:34872212-34872234 AAAGGGGCCAAGGTACAGCTTGG - Intronic
1022964300 7:35458244-35458266 AAAGGGACCAATGTAGAGCTCGG - Intergenic
1023060460 7:36321567-36321589 AAAGGGGCCAAGGCACAGCTTGG + Intergenic
1023188561 7:37555576-37555598 AAAGGGGCCAAGGTGCAGCTGGG - Intergenic
1023558814 7:41450942-41450964 AGATGTGCCTACATAGAGCTGGG - Intergenic
1023650542 7:42364496-42364518 AAAGGGGCCAATGTAGAGATTGG - Intergenic
1023786873 7:43716878-43716900 AAAGGGGCCAATGCAGAGCTTGG + Intronic
1024207544 7:47176873-47176895 AAAGGGGCCAAGGTACAGATTGG + Intergenic
1024667253 7:51559298-51559320 AAAGGGGCCAACATATAGCTTGG + Intergenic
1024684942 7:51734712-51734734 AAAGGGGCCAATGTACAGCTTGG - Intergenic
1024843949 7:53620404-53620426 AAAGGAGTCAAGATACAGCTTGG + Intergenic
1025221629 7:57115240-57115262 AAAGGGGCCAAAGTACAGCTTGG - Intergenic
1025632411 7:63286908-63286930 AAAGGGGCCAAAGTACAGCTTGG - Intergenic
1025650150 7:63459322-63459344 AAAGGGGCCAAAGTACAGCTTGG + Intergenic
1025721560 7:64020414-64020436 AAAGGGGCCAAGGTACAGCTTGG + Intergenic
1025743583 7:64223214-64223236 AAAAGGGCCAAGGTACAGCTTGG + Intronic
1026120141 7:67529624-67529646 AAAGGGGCCAACATACAGCTCGG - Intergenic
1027279212 7:76593525-76593547 AAAGGGGCCAAGGTATAGCTTGG - Intergenic
1027519103 7:79181425-79181447 ACAGGGGTCAAGATAGAGCTTGG - Intronic
1027549541 7:79573877-79573899 GAAGGGGCCAACATAGAGCTTGG + Intergenic
1027605371 7:80292784-80292806 AAAGGGGCCAATGTAGAGCTTGG - Intergenic
1027624740 7:80531978-80532000 AAAGGGGCCAACATAGAGCTCGG + Intronic
1027625995 7:80545513-80545535 AAAGGGGCCAATGTGGAGCTCGG + Intronic
1027666464 7:81047152-81047174 AAAGGGGCCAAGGTACAACTTGG + Intergenic
1027704345 7:81510333-81510355 AAAGGGGCCGACATACAGCTCGG + Intergenic
1027834130 7:83219175-83219197 AAAGGGGCCAAAGTAGATCTCGG + Intergenic
1028126087 7:87114960-87114982 AAAGAGGCCAATGTAGAGCTTGG + Intergenic
1028138335 7:87245687-87245709 AAAGGGGCCAACGTACTGCTCGG + Intergenic
1028249717 7:88526397-88526419 AAAAGGGCCAACAAACAGCTCGG - Intergenic
1028360034 7:89956138-89956160 AAAGGGGCCAATGTAGAGCTTGG - Intergenic
1028667905 7:93367950-93367972 AAAGGGGGCAAGAGAGAGGTGGG - Intergenic
1028745319 7:94320581-94320603 AAAGGGGCCAACATAGAGCTTGG - Intergenic
1028784223 7:94773817-94773839 AAAGGGGGCAAAGTACAGCTTGG + Intergenic
1028961062 7:96750148-96750170 AAAGGGACCAAGGTACAGCTTGG - Intergenic
1030108505 7:106007092-106007114 AAAGGGGCCAAGGTACAGCTCGG - Intronic
1030559115 7:111063268-111063290 AAAGGGGCCAAGGTACAGCTTGG - Intronic
1030749528 7:113213697-113213719 AAAAGGGCCAACTTAAAGCAAGG + Intergenic
1030786599 7:113670842-113670864 AAAGGGGCCAAGGTATAGCTTGG + Intergenic
1030789526 7:113706657-113706679 AAAGGTGCCTACATAGTGCCTGG + Intergenic
1030806807 7:113929621-113929643 AAAGGGGCCAACATACAGCCTGG + Intronic
1030826803 7:114168890-114168912 AAAGGGACAAATGTAGAGCTAGG + Intronic
1030868753 7:114731399-114731421 AAAGGGGCCAAAGTAGAGCTTGG + Intergenic
1030915161 7:115303767-115303789 AAAGGGGCCAATGTAGACCTTGG + Intergenic
1030967048 7:116005915-116005937 AAAGGGGCCAAGGTACAGCTAGG + Intronic
1030986219 7:116244922-116244944 AAAGGGGCCAAGGTATAGCTTGG - Intronic
1031158165 7:118135337-118135359 AAAGGGGCCAACATAAAGCTTGG + Intergenic
1031175029 7:118339056-118339078 AAAGGGGCCAATATACAGCTTGG + Intergenic
1031282194 7:119818655-119818677 AAGGGGGCCAATGTAAAGCTTGG + Intergenic
1031290482 7:119928339-119928361 AAAGGGGCCAATATAGAGCTTGG + Intergenic
1031298852 7:120039304-120039326 AAAGGGGCCAAGGTACAGCATGG - Intergenic
1031467992 7:122137149-122137171 AAAGTGCTCAGCATAGAGCTTGG - Intronic
1031473146 7:122191321-122191343 AAAGGGGCCAAGGTACAGCTTGG + Intergenic
1031478143 7:122247706-122247728 AAAGGGACCAAGGTACAGCTTGG + Intergenic
1031674215 7:124589141-124589163 AAAGGAGCCAATGTAGAGCTTGG + Intergenic
1031732853 7:125319879-125319901 AAACAGGCCAAAGTAGAGCTCGG + Intergenic
1031783287 7:125997456-125997478 AAAGGGGCCAACATAGAGCTCGG + Intergenic
1031791965 7:126118047-126118069 AAAGGGGCCAAGGTACAGCTTGG + Intergenic
1032053148 7:128662365-128662387 AAAGGGGACAATGTAGAGCTCGG + Intergenic
1032179225 7:129661100-129661122 AAAGGGGCCAACACAGAGCTCGG - Intronic
1032366751 7:131307099-131307121 AAAGGGGCCAAGGTACAGCTTGG + Intronic
1033456434 7:141507763-141507785 AAAGGGGCCAACATACAGCTTGG - Intergenic
1033777535 7:144629341-144629363 AAAGGGGACATGATAAAGCTCGG + Intronic
1033998751 7:147386067-147386089 AAAGGGGGCAAGATACAGCTTGG - Intronic
1034011247 7:147531523-147531545 AAAGGGGCCAATGTACAGCTTGG - Intronic
1034623063 7:152471274-152471296 AAAGGGACCACTGTAGAGCTCGG + Intergenic
1034772497 7:153793850-153793872 AAAGGGGCCAATGTAGAACTCGG + Intergenic
1034874536 7:154713608-154713630 AAAGGGGCCAACGTACAGCTTGG - Intronic
1035149917 7:156861304-156861326 AAAGGGGCCAAACAACAGCTGGG - Intronic
1035905634 8:3507042-3507064 CAAGTGCCTAACATAGAGCTTGG + Intronic
1036836279 8:12071441-12071463 AATGGGGCCGAAATAGAGTTAGG - Intronic
1036858121 8:12318010-12318032 AATGGGGCCGAAATAGAGTTAGG - Intergenic
1037048813 8:14343005-14343027 AAAGGGGCCAAGGTACAGCTTGG + Intronic
1037205996 8:16320762-16320784 AAAGGGGCCAAGGTAAAGCTTGG + Intronic
1037213923 8:16425849-16425871 AAAGGGGCCAAGAAAGACATTGG + Intronic
1037975616 8:23209080-23209102 AAAGGGGCCAAGGTACAGCTTGG + Intronic
1038139011 8:24822464-24822486 AAAGTGGCCAATGTAGAGCTTGG + Intergenic
1038907540 8:31922909-31922931 AAAAGAGCTAGCATAGAGCTGGG + Intronic
1039121929 8:34157396-34157418 AAAGTGGCCAACATAGAGCTTGG + Intergenic
1039657291 8:39423561-39423583 AAAGGGGCCAACATAGAGCTCGG - Intergenic
1040397213 8:47011334-47011356 AAAGGGGCCAACATAAAGCTTGG - Intergenic
1040644992 8:49387888-49387910 AAAGGGGCCAAGGTACAGCTTGG + Intergenic
1040791506 8:51235822-51235844 AAAGAAGCAAACATAGGGCTGGG - Intergenic
1040863446 8:52024119-52024141 AAAGAGGCCAAGGTACAGCTTGG + Intergenic
1041074966 8:54161057-54161079 AAAGGGGCCAACGTAGAGCTCGG + Intergenic
1041422966 8:57689871-57689893 TTAGTGTCCAACATAGAGCTTGG - Intergenic
1041479801 8:58307338-58307360 AAAGGGGCCGGCATAGAGCTTGG - Intergenic
1041682209 8:60605141-60605163 AAAGGGGCCCAGGAAGAGCTCGG + Intronic
1041931293 8:63289801-63289823 GAAGAGGCCAACATATAGATTGG + Intergenic
1041965110 8:63667380-63667402 AAAAGGGGCAATGTAGAGCTCGG + Intergenic
1041984855 8:63909512-63909534 AAAGGGGCCAACGTAGAGCTTGG - Intergenic
1042058001 8:64786966-64786988 AAAGGGGCCAAAGCACAGCTAGG - Intronic
1042161830 8:65904654-65904676 AAAGGGGCCAAGGTAGAGCTTGG + Intergenic
1042407564 8:68422925-68422947 AAAGGGGCCAAGGTATAGCTCGG - Intronic
1042501655 8:69515346-69515368 ACAGGGGCCAAGATAAAGCTTGG - Intronic
1042635441 8:70868499-70868521 AAAGAGGCCAATGTAGAGCTCGG - Intergenic
1042923094 8:73939551-73939573 AAAGGGGCCAACATAGAGTTTGG + Intronic
1042992350 8:74655484-74655506 AAAGGGGCCAAGGTACAGCTCGG + Intronic
1043080590 8:75760670-75760692 AAAGGGGTCAACATGGTGCTTGG + Intergenic
1043204936 8:77426251-77426273 AAAGGGGCCGAGATAAATCTCGG + Intergenic
1043345805 8:79296674-79296696 AAAGGGGCCAAGATACAGCTAGG + Intergenic
1043510494 8:80945985-80946007 AAAGGGGCCAACGTACAGCTCGG + Intergenic
1043533650 8:81176582-81176604 AAAGGGGCACAGATACAGCTGGG - Intergenic
1043680819 8:83022548-83022570 AAAGGGGTCAAAGTACAGCTTGG - Intergenic
1043834726 8:85033333-85033355 AAAGGGGCCAACATAGAGCTTGG - Intergenic
1044010088 8:86984134-86984156 AAAGTGGCAAACATAGAGCTTGG + Intronic
1044028900 8:87210598-87210620 AAAGGGGCCCATATATAGCTTGG + Intronic
1044087218 8:87955933-87955955 GAAGGGGCCAATGTACAGCTAGG - Intergenic
1044188422 8:89283812-89283834 AAAGGGGCCAAGGTACTGCTTGG + Intergenic
1044220452 8:89663548-89663570 AAAGGGGCCAAGGTACAGCTTGG - Intergenic
1044279707 8:90340941-90340963 AAAGGGTCCAATGTACAGCTTGG + Intergenic
1044295113 8:90518678-90518700 AAAGGGGCCAAGGTAAAGCTTGG + Intergenic
1044718555 8:95123779-95123801 AAAGGGGCCAATGTAGAGCTCGG + Intergenic
1044877200 8:96681365-96681387 AAAGGGGCCAAGGTACAGCTTGG + Intronic
1045050510 8:98320104-98320126 AAAGGGGCCAACATAGAGCTTGG - Intergenic
1045067215 8:98459725-98459747 AAAGGGGCCAAGGTACAGCTCGG + Intronic
1045214184 8:100130289-100130311 AAAGGGGCCAGTGTACAGCTTGG - Intronic
1045597215 8:103670179-103670201 AAAAGGGCCAAGGTACAGCTTGG - Intronic
1045995671 8:108358968-108358990 AAAGGGGCCAATGTACAGCTCGG - Intronic
1046050120 8:109012582-109012604 AAAGGGGCCAATGTACAGCTTGG + Intergenic
1046207133 8:111015303-111015325 AAAGGGGCCAATGTAGAGTTTGG + Intergenic
1046243778 8:111532256-111532278 AAAGGGGCCAAGTTAAAGCTTGG - Intergenic
1046271701 8:111904818-111904840 ACAGGGGCCAGCCTAGAGCCTGG + Intergenic
1046358344 8:113117279-113117301 AAATGGGCCAAGGTACAGCTTGG + Intronic
1046368640 8:113271454-113271476 AAAGGGGCCAAGGTACAGCTCGG + Intronic
1046372177 8:113324418-113324440 AAAGGGGACAACGTAGACCTCGG + Intronic
1046640170 8:116721207-116721229 AAAGGAGCCAAGATACAGCTTGG + Intronic
1046656319 8:116899146-116899168 AAAGAGGCCAATGTACAGCTTGG + Intergenic
1046689601 8:117267794-117267816 AAAGGGGCCAAGGTACAGCTCGG - Intergenic
1046814755 8:118571628-118571650 AAAGGAGCCAACACAGAGCTTGG + Intronic
1046929032 8:119824710-119824732 AAAGGGGCCAACTTTGAGCTTGG + Intronic
1047149143 8:122241206-122241228 AAAGGGGCCAGTATAGAGCTTGG + Intergenic
1047535063 8:125712180-125712202 CCAGGGGCCAATGTAGAGCTTGG + Intergenic
1047545633 8:125813720-125813742 AAAGGGGCCAATGTAGAGCTTGG + Intergenic
1047586893 8:126282778-126282800 AAAGGGGCCAAGGTACAGTTTGG + Intergenic
1047628038 8:126677153-126677175 AAAGGGACCAACGTACAGCTTGG + Intergenic
1047630280 8:126699459-126699481 AAAGGGGCCAATGTAGAGCTTGG + Intergenic
1047940437 8:129823521-129823543 AAAGGGGCCCAGGTACAGCTTGG + Intergenic
1048162797 8:132036584-132036606 AAAGGGGCCAGACTAGAGCCAGG + Intronic
1048181176 8:132195836-132195858 ACAGGAGCCAAACTAGAGCTAGG + Intronic
1048699989 8:137077955-137077977 AAAGGGGCCAACATAGAGCTTGG + Intergenic
1048729203 8:137418917-137418939 AAAGGGGCCAAGGTACACCTTGG - Intergenic
1048769709 8:137882600-137882622 CAAGGGGCCAACATAGAGCTTGG + Intergenic
1048782955 8:138021790-138021812 AAAGGGGCCAACATATACTTTGG + Intergenic
1048839349 8:138551352-138551374 AAAGGGGCCAAGGTACAGCTTGG + Intergenic
1048923352 8:139250212-139250234 AAAGGAGCCAATGTACAGCTCGG + Intergenic
1049076286 8:140399002-140399024 AAAGGAGCCAACATACAGCTCGG + Intronic
1049085781 8:140477545-140477567 AAAGGGGCCAACATAGAGCTTGG - Intergenic
1049862923 8:144912648-144912670 AAAGGGGCCAAGGAATAGCTTGG + Intergenic
1050255599 9:3789304-3789326 AAAGGGGCCAACATAGAGCTTGG + Intergenic
1050324655 9:4487985-4488007 AAAGTGTCTACCATAGAGCTGGG - Intergenic
1050643383 9:7693050-7693072 AAAGGGGCCAAGGTACAGCTTGG + Intergenic
1050773624 9:9234256-9234278 AAAGGGGCCAAGGTATAGCATGG - Intronic
1050905081 9:10993763-10993785 AAAGGGGCCAACATACAGCTTGG + Intergenic
1050909932 9:11055766-11055788 AAAGGGGCCAAGGTACAGCGTGG + Intergenic
1050929054 9:11301271-11301293 AAAGGGGTCAACATAGAGTTTGG - Intergenic
1050976844 9:11949714-11949736 AAAGGGGCCAAGGTACAGATTGG - Intergenic
1051309781 9:15757796-15757818 AAAGGGGCCAACGTAGAGCTTGG + Intronic
1051382244 9:16470626-16470648 AAAGGGGCCAACATACAGCTTGG + Intronic
1051573149 9:18583279-18583301 AAAGGGGTCAAGGTAGGGCTCGG + Intronic
1051619501 9:19036548-19036570 AAAGGGGCCAACATAGAGCTTGG + Intronic
1051767467 9:20540529-20540551 AAAGGGGCCAAGGTACAGCTTGG - Intronic
1051860842 9:21623264-21623286 AAAGGGCCCAATGTAGAGCTGGG - Intergenic
1051925199 9:22316918-22316940 AAAGGGGCCAAGGTACATCTTGG + Intergenic
1051957434 9:22713145-22713167 AAAGGGGCCAATGTAGAGCTTGG + Intergenic
1052168064 9:25357831-25357853 AAAGGGGCCAATGTACAGCTTGG - Intergenic
1052414251 9:28157322-28157344 AAAGGGGTCAATGTAGAGCTTGG - Intronic
1052488373 9:29131480-29131502 CAAGGGCCCAAAATAGAGCGGGG - Intergenic
1052542414 9:29828002-29828024 AAATGGGCCAAGGTACAGCTTGG + Intergenic
1052594109 9:30536788-30536810 AAAGGGATCAATACAGAGCTTGG + Intergenic
1052595921 9:30558381-30558403 AAAGGGGCCAACGCAGAGCTTGG - Intergenic
1052614509 9:30821142-30821164 AAAGGGGCCAATGTACAGCTTGG + Intergenic
1052637281 9:31121596-31121618 AAAGGGGCCAATGTACAGCTTGG - Intergenic
1052767965 9:32660700-32660722 AAAGGGGTCAATGAAGAGCTTGG - Intergenic
1052846424 9:33340336-33340358 AAAGGGGCCAACACAGAGCTTGG - Intronic
1053371324 9:37564117-37564139 AAAGGGGCCAAGGTACAGCTTGG + Intronic
1053384190 9:37673795-37673817 AAAGGGGCCAATGTACAGCTTGG - Intronic
1053574494 9:39345026-39345048 AAAGGGTCCAAGGTACAGCTTGG + Intergenic
1053625605 9:39867720-39867742 AAAGGGGCCAAGGTACAGCTTGG + Intergenic
1053782014 9:41619355-41619377 AAAGGGACCAAGGTACAGCTTGG - Intergenic
1053839057 9:42173274-42173296 AAAGGGTCCAAGGTACAGCTTGG + Intergenic
1053879253 9:42575498-42575520 AAAGGGGCCAAGGTACAGCGTGG - Intergenic
1053893408 9:42718860-42718882 AAAGGGGCCAAGGTACAGCTTGG + Intergenic
1054096058 9:60903716-60903738 AAAGGGTCCAAGGTACAGCTTGG + Intergenic
1054117521 9:61179655-61179677 AAAGGGTCCAAGGTACAGCTTGG + Intergenic
1054169966 9:61829509-61829531 AAAGGGACCAAGGTACAGCTTGG - Intergenic
1054218283 9:62382981-62383003 AAAGGGGCCAAGGTACAGCTTGG - Intergenic
1054232436 9:62526199-62526221 AAAGGGGCCAAGGTACAGCGTGG + Intergenic
1054590234 9:67002911-67002933 AAAGGGTCCAAGGTACAGCTTGG - Intergenic
1054667572 9:67751306-67751328 AAAGGGACCAAGGTACAGCTTGG + Intergenic
1055080835 9:72266291-72266313 AAAGGGGCCAACATACAGCTTGG - Intergenic
1055083457 9:72290505-72290527 AAGGGGGCCAAGGTACAGCTTGG - Intergenic
1055180498 9:73380589-73380611 AAAGGGGCCAAGGTGCAGCTAGG - Intergenic
1055264105 9:74475814-74475836 AAAGGGGCCAATGTAGAGCTCGG + Intergenic
1055341918 9:75293126-75293148 AATGGGGCCAACATGGAGCTTGG - Intergenic
1055384617 9:75747733-75747755 AAAGGGGCCAGCATACAGTTTGG + Intergenic
1055579322 9:77691177-77691199 AAAGGGGCCAATGTAGACCTTGG - Intergenic
1055701266 9:78948073-78948095 AAAGGGGCCAAGGGACAGCTTGG + Intergenic
1055878454 9:80970657-80970679 AAAGGGGCCATTATAGAGCTCGG + Intergenic
1056087034 9:83160855-83160877 GAAGGGGCCCACATAGAGCTTGG + Intergenic
1056325513 9:85475187-85475209 AAATGAGCCAACATACAGCTTGG + Intergenic
1056625755 9:88251891-88251913 AAAGGGGCCAAGGTACAGTTTGG + Intergenic
1056806967 9:89736479-89736501 AAAGGGGCCGACAAAGACATGGG + Intergenic
1057285361 9:93749201-93749223 AAAGGGGTCAAGGTATAGCTTGG - Intergenic
1057542436 9:95987999-95988021 AAAGGGTCCAAGGTACAGCTTGG - Intronic
1057645078 9:96866325-96866347 AAAGGGGCCAAAATACAGCTTGG + Intronic
1058004596 9:99901930-99901952 AAAGGGGCCAATGTGGAGCTTGG - Intergenic
1058065666 9:100545402-100545424 AAAGGGACCAATGTAGAGCTTGG - Intronic
1058076512 9:100657142-100657164 AAAGGGGCCAACGTAGAGCTTGG + Intergenic
1058086479 9:100753328-100753350 AAAGGGGCCAAGATGCTGCTTGG - Intergenic
1058149903 9:101452621-101452643 AAAGGGGACAATGTACAGCTTGG + Intergenic
1058181705 9:101807682-101807704 AAAGGGGCCAACATACAGCCGGG + Intergenic
1058221959 9:102313897-102313919 AAAGAGACCAAGATATAGCTTGG + Intergenic
1058309721 9:103485424-103485446 AAAGGGGCCAAGGTACAGCTAGG + Intergenic
1058323070 9:103658433-103658455 AAAGGGGTCAAGGTACAGCTTGG + Intergenic
1058330772 9:103757103-103757125 AAAAGGGCCAATGTAAAGCTCGG - Intergenic
1058393672 9:104525100-104525122 AAAGGGGCCAGGGTAAAGCTTGG - Intergenic
1058401530 9:104625178-104625200 AAAGGGGCCAATGCAGAGCTCGG + Intergenic
1059045457 9:110861653-110861675 AAAGGGGCCAAGGTACAGCTTGG + Intergenic
1059195390 9:112366492-112366514 AAAGGGGCCAATATAGAGCTTGG + Intergenic
1059529378 9:115021908-115021930 AAAGGAGCTATCACAGAGCTGGG + Intronic
1059562444 9:115348221-115348243 AAAGGGGCCAATGTAGAGCTTGG - Intronic
1059601400 9:115783233-115783255 AAAGGGGCCAAGGTACAGCTTGG + Intergenic
1059763155 9:117358511-117358533 AAAGGGGCCAGCATTAAACTGGG + Intronic
1060308150 9:122434932-122434954 AAAGGGGCCGAGGTAGAGATTGG + Intergenic
1060622695 9:125082196-125082218 AAAGGGGCCGAGGTACAGCTTGG + Intronic
1061130912 9:128707195-128707217 AGAGGGGACAACGTAGAGCCAGG - Intronic
1061197127 9:129112555-129112577 AAAGAGGTGAACAAAGAGCTGGG + Intronic
1061395259 9:130340277-130340299 AAAGCAGCCAGCATAGAGCCCGG - Intronic
1062213801 9:135378329-135378351 AAGGGGGCCAACATCTTGCTGGG - Intergenic
1062616960 9:137401671-137401693 AAAGAGGCCAACATAGAGCTCGG - Intronic
1203635451 Un_KI270750v1:106291-106313 AAAGGAGCCAAGGTACAGCTTGG - Intergenic
1186052141 X:5608180-5608202 AAAGAGAACAACATAGAGCTGGG + Intergenic
1186053299 X:5623573-5623595 GAAGGGGCCAAGTTATAGCTTGG + Intergenic
1186266650 X:7840727-7840749 AAAGGAGCCAACGTACAGCTTGG - Intergenic
1186324005 X:8459091-8459113 AAAGGGGCCAATGTACAGCTTGG - Intergenic
1186584371 X:10856761-10856783 AAAGCTGCCAAAATAGAGCAGGG + Intergenic
1186700284 X:12083260-12083282 AAAGGGGCTAATGTAGAGCTTGG + Intergenic
1186742594 X:12534126-12534148 AAAGGGGCCAATGTAGAGCTTGG + Intronic
1186797669 X:13062420-13062442 AAAGGGGCCAACATAGAGCTTGG - Intergenic
1186992423 X:15084451-15084473 AAAGGGGCCAACATAGACCTCGG + Intergenic
1187072377 X:15901135-15901157 AAAGGAGCTAATGTAGAGCTTGG - Intergenic
1187615792 X:20991879-20991901 AAAGGGGCCAACATACAACTCGG - Intergenic
1187663226 X:21573629-21573651 AAAGGGGCCAAGGTATAGGTTGG - Intronic
1187667412 X:21628636-21628658 AAAGGGGCCAAGGTACAGCTTGG - Intronic
1187685675 X:21813524-21813546 AAAGGGGAGAAGTTAGAGCTGGG + Intergenic
1187796211 X:23006738-23006760 AAAGGGACCGACATAGAGCTTGG - Intergenic
1187866326 X:23726457-23726479 AAAGGGGCCAATGGCGAGCTTGG + Intronic
1187894440 X:23967095-23967117 AAAGGGGCCAAGGTACAGCTCGG - Intergenic
1188041690 X:25376423-25376445 AAAGGGGCTAAGATATAGCTTGG + Intergenic
1188106816 X:26156422-26156444 AAAGGGGCCAAGGTACAGCTCGG - Intergenic
1188115615 X:26238976-26238998 AAGGGGGCCAAGGTACAGCTTGG - Intergenic
1188155482 X:26736879-26736901 CAAGGGGCCAAAGTACAGCTTGG - Intergenic
1188187319 X:27130917-27130939 AAAGGGGTCAAGGTATAGCTCGG - Intergenic
1188196380 X:27240329-27240351 AAAGGGGCCAAGATACAGATTGG + Intergenic
1188305784 X:28558540-28558562 AAAGGGGACAAAGTACAGCTTGG - Intergenic
1188616500 X:32164870-32164892 AAAGGGGCCAAGGTACAGTTCGG + Intronic
1188660415 X:32751849-32751871 AAAGGGGCCGAGGTACAGCTTGG + Intronic
1188749239 X:33885093-33885115 AAAGGGACCAAGGTACAGCTTGG + Intergenic
1188785108 X:34336247-34336269 AAAGGGGCCAACATAGAGCTTGG - Intergenic
1189028843 X:37428989-37429011 AAAGGGGCTAAGGTACAGCTTGG - Intronic
1189213355 X:39303085-39303107 AAAAGGGCCAAGGTAAAGCTTGG + Intergenic
1189371270 X:40431457-40431479 AAAGGAGCCAATGTAGAGCTTGG + Intergenic
1189431416 X:40950627-40950649 AAAGGGGCCCAGGTACAGCTTGG - Intergenic
1189562922 X:42209360-42209382 AAAGGGCCCACCATAGTGCCTGG + Intergenic
1189869659 X:45368969-45368991 AAAGGGGCCCAGGTACAGCTTGG + Intergenic
1189886066 X:45546024-45546046 AAAGGGGCCCAGGTACAGCTTGG + Intergenic
1189899439 X:45690655-45690677 AAAGGGACCCAGATACAGCTTGG + Intergenic
1190513303 X:51195784-51195806 AAAGGGGCCAACATAGAGCTTGG - Intergenic
1191020847 X:55858681-55858703 AAAGGGGCCAATGTAGAGCTCGG - Intergenic
1191062883 X:56318257-56318279 ACAGGGGCCAACATGGAGGCTGG - Intergenic
1191084065 X:56545758-56545780 AAATGGGCCAAGGTACAGCTTGG - Intergenic
1191211472 X:57889499-57889521 AAAGGGGCCAAGGTACAGCTCGG - Intergenic
1191595940 X:62944165-62944187 AAAGGGGCTAAAGTAGAGCTTGG - Intergenic
1191606917 X:63072242-63072264 AAAGGGGCCAAGGTGCAGCTTGG - Intergenic
1191735533 X:64384645-64384667 AAAGGGGCCCAGATATAGCTTGG - Intronic
1191760875 X:64647060-64647082 AAAGGGACCAACGTACAGCTTGG + Intergenic
1192270563 X:69575427-69575449 AAAGGGGCCAACATAGAGCTTGG - Intergenic
1192278938 X:69663357-69663379 AAAGGGGCCAAGGTACAACTCGG + Intronic
1192689679 X:73349255-73349277 AAAGGGGCCAAGGTACAGCTTGG + Intergenic
1192713598 X:73616718-73616740 AAATGGGCCAAGGTACAGCTTGG - Intronic
1192742417 X:73906036-73906058 AAGGGGGCCAAGGTACAGCTTGG + Intergenic
1192846268 X:74909826-74909848 AAAGGGGCCAACGTACAGCTCGG + Intronic
1192932843 X:75826000-75826022 AAAGGGGCCAAAGTACAGCATGG - Intergenic
1193153432 X:78148076-78148098 AAAGGGGTCAATGTAGAGCTTGG + Intergenic
1193183301 X:78483583-78483605 AAAGGGGCCAAAGTACAGTTTGG - Intergenic
1193210497 X:78801787-78801809 AAAGGGGCAAAGGTACAGCTTGG + Intergenic
1193226445 X:78989631-78989653 AGAGGGGCCAATGTAGAACTTGG + Intergenic
1193320386 X:80114800-80114822 AAAGAGGCCAAGGTACAGCTCGG + Intergenic
1193412689 X:81183465-81183487 AAAGGGGCCCAGATGCAGCTTGG + Intronic
1193438973 X:81515518-81515540 AAAGTGGCCAAAGTAGAGCTTGG + Intergenic
1193492032 X:82162165-82162187 AAAGGGGGCAAGGTACAGCTTGG + Intergenic
1193519604 X:82512478-82512500 AAAGGGGCCAACATAGAGCTCGG - Intergenic
1193547299 X:82845874-82845896 AAAGGGGCCTAGGTACAGCTTGG + Intergenic
1193585660 X:83318531-83318553 AAAGGAGCCAAGGTACAGCTTGG + Intergenic
1193662525 X:84274436-84274458 AAAGGGGCCAATGTAGATCTTGG - Intergenic
1193706256 X:84823703-84823725 AAAGGGGCCAAAGTACAGCTTGG - Intergenic
1193707896 X:84845006-84845028 AAAGGAGCAAATGTAGAGCTTGG - Intergenic
1193711321 X:84883920-84883942 AAAGGAGCAAATGTAGAGCTTGG + Intergenic
1193759195 X:85443347-85443369 AAAGGGGCCAATGTACAGCTTGG - Intergenic
1193813752 X:86082077-86082099 AAAGGGGCCAAGGTACAGCTAGG - Intergenic
1193842046 X:86418539-86418561 AAATGGGCCAACATAGAGCTGGG - Intronic
1193845639 X:86466834-86466856 AAAGGGGCCAACGTAGAGCTGGG - Intronic
1193995997 X:88366417-88366439 AAAGGGCCCTAGATACAGCTTGG - Intergenic
1194082568 X:89486784-89486806 AAAGGGGCTATGATACAGCTTGG - Intergenic
1194135000 X:90130440-90130462 AAAGGGGCCAAGGTACAGTTTGG + Intergenic
1194168882 X:90557238-90557260 AAAGGGCTCCAGATAGAGCTTGG + Intergenic
1194185014 X:90765200-90765222 AAGGGGGCCAAGGTATAGCTCGG - Intergenic
1194215807 X:91129056-91129078 AAAGGGGCCAACATAGAGCTTGG - Intergenic
1194253989 X:91613801-91613823 AAAGGGGCCAAAATATAGCTTGG - Intergenic
1194256904 X:91646085-91646107 AAAGGGGCCAACATAGAGTTTGG + Intergenic
1194264514 X:91738441-91738463 AAAGGGGCCAATGTACAGCTTGG + Intergenic
1194297370 X:92143470-92143492 AAAGGGGCCAACGTAGAGCTTGG + Intronic
1194320594 X:92441504-92441526 AAAGGGGCCAAGGTAGAGTTTGG + Intronic
1194364400 X:92996291-92996313 AAAGGGGCCAACATAGAGCTTGG + Intergenic
1194372255 X:93088547-93088569 ACAGGGGCCAAGATACAGTTTGG + Intergenic
1194389608 X:93299984-93300006 AAAGGGGACAAGGTATAGCTTGG + Intergenic
1194435047 X:93859881-93859903 AAAGGGACCAAGGTACAGCTTGG + Intergenic
1194473947 X:94335530-94335552 AAAGGGGCCAACATACAGCTGGG + Intergenic
1194484492 X:94471145-94471167 AAAGGGGCCAGTATAGAGCTTGG + Intergenic
1194496354 X:94621454-94621476 AAAGGGGCCAATGTACAGCTGGG - Intergenic
1194499161 X:94658726-94658748 AAAGGGGCAAAGGTAAAGCTTGG + Intergenic
1194534269 X:95086192-95086214 AAAGGGGCCAAGGTACAGCTTGG - Intergenic
1194548906 X:95272586-95272608 AAAGGGGCAAAGGTATAGCTTGG - Intergenic
1194572777 X:95574004-95574026 AAAGGGTCCCAGATAAAGCTTGG + Intergenic
1194624584 X:96213438-96213460 AAAGGGGCCAAGCTACAGCTTGG - Intergenic
1194662098 X:96639074-96639096 AAAGGAGCCAACATAGAGCTTGG + Intergenic
1194828975 X:98597148-98597170 AAAGGGGCCAACATACAGCTTGG - Intergenic
1194864900 X:99053829-99053851 AAAGAGGCCAATGTACAGCTTGG + Intergenic
1194876949 X:99201159-99201181 AATGGGGCCAACATAGAGCATGG + Intergenic
1194895267 X:99432459-99432481 AAAGGGGCCCAGGTACAGCTCGG + Intergenic
1194910107 X:99631092-99631114 AAAGGGGCCAAGGTACAGCTTGG - Intergenic
1194929402 X:99867840-99867862 AAAGGAGCCAACATACAGCTCGG + Intergenic
1194982325 X:100453247-100453269 AAAGGGGCCAAGGTACAGCACGG + Intergenic
1195126757 X:101815607-101815629 AAAGGGGCCAAGTTACAGCTTGG - Intergenic
1195154531 X:102109938-102109960 AAAGGGGCTAAGGTACAGCTTGG + Intergenic
1195196072 X:102499029-102499051 AAAGGGGTCAATGTACAGCTTGG + Intergenic
1195210101 X:102646248-102646270 AAAGGGGCCAACATACAGCTTGG - Intergenic
1195525931 X:105889736-105889758 AAAGGGGCCAAGGTACAGCTTGG - Intronic
1195536293 X:106012716-106012738 AAAGGGGCCAAGGTACAGCTCGG + Intergenic
1195545219 X:106106087-106106109 AAAGGGGCCAAGGTATAGCTTGG + Intergenic
1195815288 X:108878372-108878394 TAAGGGGCCAAGGTACAGCTTGG - Intergenic
1195863698 X:109407709-109407731 AAAGGGGCCAACATAAAGCTTGG + Intronic
1196029035 X:111075409-111075431 AAAGGGCCCTAGATACAGCTCGG + Intronic
1196036393 X:111149641-111149663 AAAGGGGCCAACATACAGCTTGG - Intronic
1196223580 X:113139459-113139481 AAAGGGGCCAAGATACAGCTTGG - Intergenic
1196278544 X:113796664-113796686 AAAGGGGCCAAGGTACTGCTTGG + Intergenic
1196391320 X:115210342-115210364 TAAGGGGCCAAGGTACAGCTTGG + Intronic
1196503325 X:116411166-116411188 AAAGGGGCCAAGATACAGCTTGG + Intergenic
1196540405 X:116900556-116900578 CAAGGGGCCAACATATAGCTCGG - Intergenic
1196559296 X:117126543-117126565 AAAGAGGACAACATAGAGCTTGG + Intergenic
1197040407 X:121929788-121929810 AAAGGGGCCAAGGTGCAGCTTGG + Intergenic
1197061333 X:122184873-122184895 AAAGGCTCCAACATAGAGCTTGG - Intergenic
1197074768 X:122341171-122341193 AAAGGGGCCAAGGTACAGCTTGG - Intergenic
1197075062 X:122343674-122343696 AATGGGGCCAAGGTACAGCTTGG - Intergenic
1197094309 X:122574939-122574961 AAAGGGGCCCAGGTACAGCTTGG - Intergenic
1197109578 X:122756587-122756609 AAAGGGGCCAAGGTACAGCTTGG - Intergenic
1197202321 X:123759032-123759054 AAAAGGGCCAAGGTACAGCTTGG + Intergenic
1197301719 X:124789155-124789177 AAAGGGGCCAAGGTACAACTCGG - Intronic
1197341009 X:125266433-125266455 AAAGGGGCTAATGTAGAGCTCGG + Intergenic
1197372942 X:125646799-125646821 AAAGGGGCCAAGGTACAGCTTGG - Intergenic
1197385483 X:125796218-125796240 AAAGGGGCCCAGGTAGAGCTGGG + Intergenic
1197387737 X:125821653-125821675 AAAGGGGCCAAGGTCCAGCTTGG - Intergenic
1197400112 X:125979542-125979564 AAAGGGGCCAATGTAGAGCTCGG - Intergenic
1197411302 X:126119526-126119548 AAAGGGGCCAACATATAGCTTGG + Intergenic
1197437730 X:126452950-126452972 AAAGGGGCCAATGTAGAGCTGGG + Intergenic
1197442857 X:126512041-126512063 AAAGGGGCCAAAGTACAGCTTGG - Intergenic
1197536162 X:127691357-127691379 AAAGGGGCCAAAGTAAAGCTTGG + Intergenic
1197547069 X:127838474-127838496 AAAGGGCCAAATGTAGAGCTTGG - Intergenic
1197567182 X:128101766-128101788 AAAGGGGTCAACATACAGGTCGG - Intergenic
1197583234 X:128311024-128311046 AAAGGGGCCAACGTAGAGCTCGG - Intergenic
1197910965 X:131482332-131482354 AAAGGGGCCAATGCAAAGCTTGG + Intergenic
1197914552 X:131520963-131520985 AAAGGGGCCAATGTACAGCTTGG + Intergenic
1198205076 X:134458275-134458297 AAAGTGCCTAGCATAGAGCTTGG - Intergenic
1198304663 X:135368644-135368666 AAGGGGGCCAAGGTACAGCTAGG - Intergenic
1198569757 X:137942299-137942321 AAAGGGGCCAACATGGAGCTTGG + Intergenic
1198608679 X:138373054-138373076 AAAGGGGCCAAGATAAACTTGGG + Intergenic
1198872800 X:141193786-141193808 AAAGGGGCCAAGGTACACCTCGG + Intergenic
1198913412 X:141638621-141638643 AAAGGGGCCAAGGTACAGCTTGG - Intronic
1199071146 X:143476952-143476974 AAAGTGGCCAAGGTACAGCTTGG + Intergenic
1199112110 X:143947179-143947201 AAAAAGGCCAATGTAGAGCTTGG + Intergenic
1199113295 X:143959553-143959575 AAAGGGGCCAATGTAGAGCTTGG - Intergenic
1199157901 X:144571942-144571964 AAAGGGGCCAAGTTGCAGCTTGG + Intergenic
1199220346 X:145309667-145309689 AAAGGGGCCAAGGTACAGCTTGG - Intergenic
1199250765 X:145659407-145659429 AAAGGGGGCAATGTACAGCTTGG + Intergenic
1199317751 X:146400538-146400560 AAAGGGGCCAAGGTACAGCTCGG + Intergenic
1199346515 X:146747025-146747047 AAAGGGGCCAAGGTACAGCTTGG - Intergenic
1199357161 X:146875709-146875731 AAAGGGGCCAAGGTACAGCTTGG + Intergenic
1199458730 X:148059476-148059498 AATGGGGCCAAGGTAGAGCTCGG - Intergenic
1199580758 X:149357851-149357873 AAAGGGGCCAAGGTACAGCTTGG + Intergenic
1199580766 X:149357884-149357906 AAAGGGGCCAAGATACAGCTTGG + Intergenic
1199806507 X:151305730-151305752 AAAGGGGACAAGGTACAGCTTGG - Intergenic
1199820795 X:151443530-151443552 AAAGGGGCCAACATAGAGCTCGG + Intergenic
1199823227 X:151471484-151471506 AAAGGGACCAAGGTACAGCTTGG - Intergenic
1199869770 X:151888022-151888044 AAAGAGGCCAAGGTACAGCTTGG + Intergenic
1199909633 X:152271826-152271848 AAAAGGGCCAATGTATAGCTCGG + Intronic
1199928409 X:152493975-152493997 AAAGAGGCCAAGGTACAGCTCGG + Intergenic
1199931851 X:152531049-152531071 AAAGGGGCAAAAGTATAGCTTGG - Intergenic
1200435216 Y:3142665-3142687 AAAGGGGCTATGATACAGCTTGG - Intergenic
1200480785 Y:3700531-3700553 AAAGGGGCCAAGGTACAGTTTGG + Intergenic
1200515126 Y:4135023-4135045 AAAGGGCTCCAGATAGAGCTTGG + Intergenic
1200531641 Y:4347309-4347331 AAGGGGGCCAAGGTATAGCTCGG - Intergenic
1200572773 Y:4853378-4853400 AAAGGGGCCAAAATATAGCTTGG - Intergenic
1200575623 Y:4885352-4885374 AAAGGGGCCAACATAGAGTTTGG + Intergenic
1200614941 Y:5368371-5368393 AAAGGGGCCAACGTAGAGCTTGG + Intronic
1200628709 Y:5554639-5554661 AAAGGGGCCAAGGTAGAGGTTGG + Intronic
1200672631 Y:6112556-6112578 AAAGGGGCCAACATAGAGCTTGG + Intergenic
1200680308 Y:6202591-6202613 ACAGGGGCCAAGATACAGTTTGG + Intergenic
1201452238 Y:14129093-14129115 AAAGGGGCTAACATAGAGCTTGG + Intergenic
1201538531 Y:15080125-15080147 AAAGAGAACAACATAGAGGTGGG - Intergenic
1202030854 Y:20572686-20572708 AAAGGGGCCAAAGTACAGCTTGG - Intergenic