ID: 966665058

View in Genome Browser
Species Human (GRCh38)
Location 3:182463219-182463241
Sequence AAGGGGCCAACATAGAGCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 3164
Summary {0: 58, 1: 243, 2: 464, 3: 870, 4: 1529}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966665052_966665058 -4 Left 966665052 3:182463200-182463222 CCGCTCCACTCATGGCTGAAAGG No data
Right 966665058 3:182463219-182463241 AAGGGGCCAACATAGAGCTTGGG 0: 58
1: 243
2: 464
3: 870
4: 1529
966665048_966665058 9 Left 966665048 3:182463187-182463209 CCTTGCATCCCAGCCGCTCCACT No data
Right 966665058 3:182463219-182463241 AAGGGGCCAACATAGAGCTTGGG 0: 58
1: 243
2: 464
3: 870
4: 1529
966665047_966665058 24 Left 966665047 3:182463172-182463194 CCTAGGGACTTGGTGCCTTGCAT 0: 13
1: 266
2: 479
3: 824
4: 1089
Right 966665058 3:182463219-182463241 AAGGGGCCAACATAGAGCTTGGG 0: 58
1: 243
2: 464
3: 870
4: 1529
966665050_966665058 1 Left 966665050 3:182463195-182463217 CCCAGCCGCTCCACTCATGGCTG No data
Right 966665058 3:182463219-182463241 AAGGGGCCAACATAGAGCTTGGG 0: 58
1: 243
2: 464
3: 870
4: 1529
966665056_966665058 -9 Left 966665056 3:182463205-182463227 CCACTCATGGCTGAAAGGGGCCA No data
Right 966665058 3:182463219-182463241 AAGGGGCCAACATAGAGCTTGGG 0: 58
1: 243
2: 464
3: 870
4: 1529
966665051_966665058 0 Left 966665051 3:182463196-182463218 CCAGCCGCTCCACTCATGGCTGA No data
Right 966665058 3:182463219-182463241 AAGGGGCCAACATAGAGCTTGGG 0: 58
1: 243
2: 464
3: 870
4: 1529

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966665058 Original CRISPR AAGGGGCCAACATAGAGCTT GGG Intergenic
Too many off-targets to display for this crispr