ID: 966665060

View in Genome Browser
Species Human (GRCh38)
Location 3:182463225-182463247
Sequence CCAACATAGAGCTTGGGCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1233
Summary {0: 19, 1: 55, 2: 160, 3: 349, 4: 650}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966665051_966665060 6 Left 966665051 3:182463196-182463218 CCAGCCGCTCCACTCATGGCTGA No data
Right 966665060 3:182463225-182463247 CCAACATAGAGCTTGGGCCATGG 0: 19
1: 55
2: 160
3: 349
4: 650
966665052_966665060 2 Left 966665052 3:182463200-182463222 CCGCTCCACTCATGGCTGAAAGG No data
Right 966665060 3:182463225-182463247 CCAACATAGAGCTTGGGCCATGG 0: 19
1: 55
2: 160
3: 349
4: 650
966665050_966665060 7 Left 966665050 3:182463195-182463217 CCCAGCCGCTCCACTCATGGCTG No data
Right 966665060 3:182463225-182463247 CCAACATAGAGCTTGGGCCATGG 0: 19
1: 55
2: 160
3: 349
4: 650
966665056_966665060 -3 Left 966665056 3:182463205-182463227 CCACTCATGGCTGAAAGGGGCCA No data
Right 966665060 3:182463225-182463247 CCAACATAGAGCTTGGGCCATGG 0: 19
1: 55
2: 160
3: 349
4: 650
966665048_966665060 15 Left 966665048 3:182463187-182463209 CCTTGCATCCCAGCCGCTCCACT No data
Right 966665060 3:182463225-182463247 CCAACATAGAGCTTGGGCCATGG 0: 19
1: 55
2: 160
3: 349
4: 650
966665047_966665060 30 Left 966665047 3:182463172-182463194 CCTAGGGACTTGGTGCCTTGCAT 0: 13
1: 266
2: 479
3: 824
4: 1089
Right 966665060 3:182463225-182463247 CCAACATAGAGCTTGGGCCATGG 0: 19
1: 55
2: 160
3: 349
4: 650

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966665060 Original CRISPR CCAACATAGAGCTTGGGCCA TGG Intergenic
901066886 1:6498504-6498526 CCAGCTTAGAGCTTGGCTCATGG - Intronic
901259321 1:7860089-7860111 CGAACATTGAGCATGTGCCAGGG + Intergenic
902115317 1:14116387-14116409 CCAACATAGAGCTTGGGTCTTGG + Intergenic
902271232 1:15306645-15306667 CCAACATAGAGCTTGGGCTGTGG + Intronic
903489666 1:23718786-23718808 CCATCAAAGAGTTTGGGCAAGGG + Intergenic
904572053 1:31473563-31473585 CCAATGTAGAGCTTGGGCTGTGG - Intergenic
904999214 1:34655172-34655194 CCCACCTTGAGCTTGGGCCCTGG - Intergenic
906230295 1:44156875-44156897 CCAGCAGAGAGCTTGAGCCCAGG - Intergenic
906463769 1:46058111-46058133 CCAACATAGGGCTCAGGCCATGG + Intronic
906763996 1:48409762-48409784 CTAACATAGAGCTTGGGTCGTGG - Intronic
906770037 1:48475548-48475570 CCAACATAGAGATAGGGCTGTGG + Intergenic
907007793 1:50932949-50932971 CCAACATAGAGCTTGGGCTATGG - Intronic
907439234 1:54468627-54468649 CCAATGTAGAGCTAGGGCCATGG + Intergenic
907522295 1:55032060-55032082 TCAACATACAGCTTGGGCTGTGG + Intergenic
907625145 1:56022394-56022416 CCAACGTGGAGCTTGGGCTGTGG - Intergenic
907925653 1:58953198-58953220 CCAACATAGAGCTTGGGCTGTGG + Intergenic
908006907 1:59737034-59737056 CCAACATAGAGCTCAGGCCATGG + Intronic
908011889 1:59786545-59786567 CCATTGTAGAGCTTGGGCCATGG - Intergenic
908047358 1:60184944-60184966 CCAACATAGAGCTCAGGCCATGG - Intergenic
908487674 1:64611042-64611064 CCAAGGCACAGCTTGGGCCATGG - Intronic
908729190 1:67208524-67208546 CCAACATCCAGCTTGGGCTGTGG + Intronic
908881979 1:68742944-68742966 CCAAGGTACATCTTGGGCCATGG + Intergenic
908911201 1:69073605-69073627 CCAAAGGAGAGCTTGGGCCATGG - Intergenic
908919258 1:69170156-69170178 CCAAGGTAGAGCTCAGGCCATGG + Intergenic
908936532 1:69383363-69383385 CGAACATAGAGCTTGGGCTGTGG - Intergenic
908967866 1:69787617-69787639 CCAACATAGAGCTCAGGCCATGG - Intronic
909065586 1:70931650-70931672 CCAACATACAGCTTGGCCCATGG - Intronic
909096088 1:71290833-71290855 CCAATGTAGAGCTTGGGCTGTGG + Intergenic
909104507 1:71391925-71391947 CCAACATTGAGCTCAGGCCGTGG + Intergenic
909185384 1:72480175-72480197 CCAACATAGAGCTCAGGCTGTGG - Intergenic
909192584 1:72572974-72572996 CCAATGTAGAGCTTGGGCCATGG + Intergenic
909200758 1:72687690-72687712 CCAACATAGAGCTCAGGCTATGG - Intergenic
909250227 1:73344202-73344224 CCAACTTAGAGCTTGGGCCATGG + Intergenic
909371189 1:74885133-74885155 CCAAGGTAGAGTTTGAGCCATGG + Intergenic
909457760 1:75869616-75869638 CCAACACACAGCTCGGGCCATGG + Intronic
909632948 1:77786151-77786173 CCACCATAGAGCTTGGGCTGTGG - Intronic
909719797 1:78754614-78754636 CCAAGATACATCTTGGCCCACGG + Intergenic
909808826 1:79905852-79905874 CCAACACAGAACTTGGGCCATGG - Intergenic
909826022 1:80127811-80127833 CTAAGGTAGAGTTTGGGCCATGG - Intergenic
910057659 1:83051154-83051176 CCAACGTACAGCTTGGGCTGTGG - Intergenic
910064900 1:83141231-83141253 CCAAGGAATAGCTTGGGCCATGG + Intergenic
910103064 1:83599131-83599153 CCAAGGTACAGCTTGGGCCATGG - Intergenic
910166892 1:84337468-84337490 CCAATGTAGAGCTTGGGTCGTGG - Intronic
910256142 1:85249127-85249149 CCAACGTAGAGCTCAGGCCATGG - Intergenic
910628888 1:89337057-89337079 CCAACATACAGCTTGAGCTGTGG + Intergenic
911242098 1:95478254-95478276 TCAAGGTACAGCTTGGGCCATGG + Intergenic
911358487 1:96849108-96849130 CCAAGGTACAGCTTGGCCCATGG + Intergenic
911465825 1:98251420-98251442 CCATTGTAGAGATTGGGCCATGG + Intergenic
911500582 1:98680205-98680227 CCAACATAGAGCTCAGGTCATGG - Intronic
911530384 1:99036870-99036892 CCAATGTAGAGCTCGGGCCGTGG - Intergenic
911541592 1:99163994-99164016 CCAACGTAGAGCTGGGGCCATGG + Intergenic
911686287 1:100780832-100780854 CCAACATAGAGCTCAGGCTGTGG - Intergenic
911904337 1:103547995-103548017 CCAACAAAGAGCTTGGGTGGTGG - Intronic
912121682 1:106479437-106479459 CCAAAATAGAGATTGGGCCATGG + Intergenic
912147334 1:106809657-106809679 CCAAGGTACAGCTGGGGCCATGG - Intergenic
912165659 1:107039792-107039814 CCAATGTAGAGCTTGGGCCATGG + Intergenic
912579158 1:110704675-110704697 CTAACATAGAGTTCAGGCCATGG - Intergenic
912890420 1:113524020-113524042 CCAAGGTACAGCTCGGGCCATGG + Intronic
913336917 1:117717156-117717178 CCAAAGTAGAGCTCAGGCCATGG + Intergenic
913710008 1:121473313-121473335 CCAAGGTACAGCTTGGGCTATGG - Intergenic
914230507 1:145761473-145761495 CCAACATAGAGCTTGGGTTGTGG + Intronic
914960655 1:152203738-152203760 CACACATATAGTTTGGGCCAAGG + Intergenic
916063141 1:161115895-161115917 CCAGCAGAGTGCTTGGCCCATGG + Intronic
916318749 1:163479589-163479611 CCAAAGTAGAGCTTGGGCCATGG + Intergenic
916467196 1:165084305-165084327 CCAATATAGAGCTTGGGCCATGG + Intergenic
917002500 1:170375154-170375176 CCCAGGTACAGCTTGGGCCATGG - Intergenic
917022245 1:170601960-170601982 CCAACATAGAGCTCTGGCTGTGG - Intergenic
917035462 1:170743168-170743190 CCAAGATAGAGCTTGGGCTGTGG - Intergenic
917082629 1:171272149-171272171 CCAACATAGAGCTCAGGCAGTGG + Intronic
917290830 1:173470913-173470935 CCAATATACAGCTTGGGCCATGG + Intergenic
917547304 1:175984299-175984321 CCAACAGAGAACTCGAGCCATGG + Intronic
917681834 1:177375494-177375516 CCAACATAGAACTTAGGCCATGG - Intergenic
917892427 1:179452993-179453015 CCAACATAGAGCTCAGGCTGTGG + Intronic
917894933 1:179478479-179478501 CCAAGATACAGCTGGGGCCATGG - Intronic
918079475 1:181194784-181194806 CCTACATAGAGCTTGGGCCATGG + Intergenic
918718156 1:187818228-187818250 CCAACATAGAGCTTGGGCCATGG - Intergenic
918787051 1:188776091-188776113 CCAACATTGAGCTTGGGCTGTGG + Intergenic
918871240 1:189977636-189977658 CCAGCATAGAGCTTGGGCTGTGG - Intergenic
919156811 1:193776119-193776141 CCAAGGTACAGCTTGGGCCGTGG - Intergenic
919175147 1:194010356-194010378 CCAATGTAGAGCTCGGGTCATGG + Intergenic
919209098 1:194455992-194456014 CCAACATACAGCTTGGGCTATGG - Intergenic
919221802 1:194639506-194639528 CTAACATAGAGCTTGGGACATGG + Intergenic
919222102 1:194642593-194642615 CCAACATAGAGCTTGGGCCATGG + Intergenic
919242711 1:194935788-194935810 CCAGCATAGAGCTTGGGCCATGG + Intergenic
919460574 1:197872157-197872179 TCAATGTAGAGCTTGGGCCATGG - Intergenic
919554313 1:199031744-199031766 TAAACATAGAGTTTGGGCCATGG - Intergenic
919758454 1:201081110-201081132 CCTACATAGAGCCAGGGCCCTGG - Intronic
919878661 1:201888598-201888620 CCAGCATAGTGATTGGGCCCAGG + Intergenic
920098640 1:203502770-203502792 CCAGCACAGAGCTTGGCGCATGG + Intronic
920597922 1:207291746-207291768 CCAACACAGAGCTCAGGCCATGG + Intergenic
920850340 1:209624095-209624117 CAAACAGAGACCTTGGGCAAAGG + Intronic
920895984 1:210049789-210049811 CCACCACAGAGCTCGGGCCGTGG - Intronic
921496897 1:215853261-215853283 CCAATGTAGAGCTTGGGCCACGG - Intronic
921716007 1:218417795-218417817 CCAACATAGAGCTTGGGCCATGG + Intronic
921763168 1:218940482-218940504 TCAATGTAGAGCTTGGGGCATGG + Intergenic
921773544 1:219071496-219071518 CCAACATAGAGCTTGGGCTATGG + Intergenic
922115382 1:222608113-222608135 CCAGTGTAGAGCTTGGGCCATGG - Intergenic
922164083 1:223100544-223100566 CCAATGTAGAGCTCGGGCCGTGG + Intergenic
923198008 1:231686463-231686485 CCAACATAGAGCTCGGGCCGTGG - Intronic
923687360 1:236162647-236162669 CCAACGTAGAGCTCGGGCTGTGG + Intronic
1063626242 10:7692454-7692476 CTAATCTAGAGCTTAGGCCATGG - Intergenic
1066040780 10:31546382-31546404 CCAATGTAGAGCTAGGGCCATGG - Intergenic
1066479975 10:35786265-35786287 CCAGCATAGAGCTCGGGCCACGG - Intergenic
1066636822 10:37511454-37511476 CCAACATAGAGCTTGGTCTGTGG + Intergenic
1067812317 10:49439367-49439389 CCAACATAGAGCTCAGGCCATGG - Intergenic
1068011300 10:51455158-51455180 CCAAGGTAGAGCTTGGGCTGTGG - Intronic
1068229852 10:54157410-54157432 CCAACATAGAGCTCAGGCTGTGG - Intronic
1068400325 10:56519263-56519285 CCAACATACAGCTTGGGCTGTGG - Intergenic
1068416831 10:56734129-56734151 CCAAAAAAGAGCTTGGGCTGTGG - Intergenic
1068439423 10:57032235-57032257 ACAATGTAGAGCTTGGGCCGTGG + Intergenic
1068449356 10:57165726-57165748 CCAAGGTACAGCTTGAGCCATGG - Intergenic
1068908359 10:62351902-62351924 ACAACATAGAGCTTGGGTTGTGG - Intergenic
1069070002 10:63983265-63983287 CCAACGTAGAGCTTGGGCTGTGG + Intergenic
1069173621 10:65262857-65262879 CCAACATAGAGTTCGGGCTGTGG - Intergenic
1069175759 10:65286502-65286524 CCAACATAGAGCTCGGGCTGTGG - Intergenic
1069211050 10:65760605-65760627 CCAACATAGAGCTCGGGCTGTGG - Intergenic
1069239664 10:66123793-66123815 CAAATGTCGAGCTTGGGCCATGG - Intronic
1069367857 10:67712550-67712572 CCAATATAGAGGTCCGGCCATGG + Intergenic
1069449518 10:68505069-68505091 CCCACAGATAGCTTGGGCCCAGG + Intronic
1069751944 10:70750447-70750469 CCTTCCTAGAGCATGGGCCAGGG + Intronic
1069803882 10:71105119-71105141 CCAACATAGAGCTCAGGCTGTGG - Intergenic
1069805183 10:71117898-71117920 CCAACGTAGAGCTTGGGCCGTGG + Intergenic
1070633492 10:78105517-78105539 TGAATGTAGAGCTTGGGCCATGG + Intergenic
1070651845 10:78243150-78243172 CCAACGTAGAGCTTGGGCTGTGG + Intergenic
1071442881 10:85718606-85718628 CCAACACAGAGCTTGGGCTGTGG - Intronic
1071482984 10:86078909-86078931 CTGACATAGAGCTGGGTCCAGGG - Intronic
1071550069 10:86560056-86560078 CTAATGTAGAGCTTGGGCCATGG - Intergenic
1071577806 10:86742373-86742395 CTAACATAGAGCATGAACCAGGG - Intergenic
1071981038 10:91004498-91004520 CCAAGGTACAGCTCGGGCCATGG - Intergenic
1072488033 10:95874870-95874892 CCAACATAGAGCTTGGGCTGTGG - Exonic
1072946992 10:99819289-99819311 ACAAGATAGAACTTGGGCCATGG + Intronic
1073387030 10:103134382-103134404 CCAATATAGAGCTCGGGCTGTGG + Intronic
1073864577 10:107787204-107787226 CCAAGGTACAGCTTAGGCCATGG + Intergenic
1073880567 10:107975186-107975208 CCAAGGTACAGCTTGGCCCATGG - Intergenic
1074041430 10:109793414-109793436 CCAACATGCAGCTTGGGCTGTGG - Intergenic
1074262718 10:111870321-111870343 CCAATGTAGAGCTCGGGCTATGG + Intergenic
1074451926 10:113566507-113566529 CTAGCATAGAGCTTGGCACATGG - Intronic
1074640233 10:115371005-115371027 CCAAGGTACAGCTTGGGCCATGG + Intronic
1074711060 10:116177885-116177907 CCACCAGAGAGCCAGGGCCATGG + Intronic
1074836792 10:117303752-117303774 CCAACGTATAGCTTGGGCTGTGG + Intronic
1074965825 10:118490042-118490064 CCAAAATAGAGCTCAGGCCATGG + Intergenic
1075281671 10:121144073-121144095 CCAAGGTACAGCTTGGGCCATGG - Intergenic
1075543684 10:123337405-123337427 CCAACATAGAGCTCAGGCTGTGG - Intergenic
1075867926 10:125743533-125743555 CCAACATAGAGCCTGGCACATGG - Intronic
1076225679 10:128773137-128773159 CCAACATAGAGCTTGGGTCATGG + Intergenic
1076464844 10:130671986-130672008 CCAACATAGAGCTCAGGCTCTGG - Intergenic
1076760095 10:132599866-132599888 CCAACATACAGCTCGGGCTGTGG - Intronic
1077942569 11:6859142-6859164 CCAACCTAGAGCTTGGGTCGTGG - Intergenic
1078117373 11:8466946-8466968 CCAACATAGAGCTCGGGCCATGG - Intronic
1078379720 11:10829271-10829293 CCAAGGTACAGCTTGGGTCATGG - Intronic
1078496734 11:11824992-11825014 CCAACATAGAGCTTGGGCCATGG - Intergenic
1079123167 11:17699398-17699420 CCAAGAGGGATCTTGGGCCATGG - Intergenic
1079143832 11:17833236-17833258 CCAACGTAGAGCTTGGGCCGTGG + Intronic
1079181964 11:18201639-18201661 CCAACATAGAGCTTGAGCCATGG - Intronic
1079341059 11:19612112-19612134 CCAATGTAGAGCTTGGGCCATGG - Intronic
1079500267 11:21094692-21094714 CCAACATAGAGTTCAGGCCATGG - Intronic
1079559438 11:21803973-21803995 CCAACATACAGCTTGGGCTGTGG - Intergenic
1079739187 11:24036264-24036286 CCAATATAGAGCTTGGACCATGG + Intergenic
1079798931 11:24844761-24844783 CCAACATAGAACTCGGGCCATGG + Intronic
1079880584 11:25922034-25922056 CCAACATAGAGCTTGGGCTGTGG - Intergenic
1079886844 11:26000934-26000956 CCAAGATACAGCTTGGGCTGTGG - Intergenic
1079962455 11:26941084-26941106 TTAACATAGAGCTTGGGCCGTGG - Intergenic
1080183011 11:29446391-29446413 CCAGTGTAAAGCTTGGGCCATGG + Intergenic
1080204912 11:29717308-29717330 CCAACATAGAGCTCAGGTCATGG - Intergenic
1080215182 11:29832060-29832082 CCAAGATACAACTTGGGCCATGG + Intergenic
1080715663 11:34797555-34797577 CCAAGATACAGCTCAGGCCATGG + Intergenic
1080717604 11:34819034-34819056 CCAACATAGAGCTCAGACCATGG - Intergenic
1080739302 11:35049025-35049047 GCAACATAGAGCTTGGGCTGTGG + Intergenic
1080817427 11:35772073-35772095 CCAACGTAGAGCTCGGGCCTTGG + Intronic
1081008158 11:37774119-37774141 CCAACATAGAGCTTGGGCTGTGG - Intergenic
1081077694 11:38696631-38696653 CCAACATAGAGCTCAGGCTGTGG - Intergenic
1081083855 11:38775142-38775164 CCAACATAGAGCTCAGGCCATGG - Intergenic
1081101421 11:39007102-39007124 CCAAGGTGCAGCTTGGGCCATGG - Intergenic
1081175446 11:39922077-39922099 TCAACGTACAGCTTGGGCCATGG + Intergenic
1081316561 11:41637664-41637686 CCAAGGTACAGCTTGGGCCGTGG - Intergenic
1081479922 11:43476621-43476643 CCAACATACAGCTTGGGCTGTGG - Intronic
1081939422 11:46928227-46928249 CTAACATAGAGCTTGGGCTGTGG + Intergenic
1083121888 11:60521050-60521072 CCAATGTAGAGCTTGGGCCATGG - Intronic
1084386337 11:68844837-68844859 CCATTATGGAGCTAGGGCCAAGG + Intergenic
1084496604 11:69508535-69508557 CAAACATAGACCTTGGGCAATGG - Intergenic
1084880712 11:72169644-72169666 CCAACATAGAGCTTAGGCCATGG + Intergenic
1085236482 11:75019461-75019483 CCAATGTAGAGCTTGGGCCATGG + Intergenic
1085866745 11:80303589-80303611 CCAACGTAGAGCTTGAGCCATGG + Intergenic
1086176752 11:83900532-83900554 CCAACATAGAGCTTGGGCTGTGG + Intronic
1086519253 11:87651113-87651135 CCAATGTACAGCTCGGGCCATGG - Intergenic
1086580374 11:88391953-88391975 CCAATGTAGAGCTCGGACCATGG - Intergenic
1086764316 11:90675772-90675794 CCAATGTAGAGCTTGGGCCATGG + Intergenic
1086826756 11:91507986-91508008 CCAACATAGAGCTCAGGTCATGG - Intergenic
1086933836 11:92722808-92722830 CCAACATAGAGCTCAGGCCATGG - Intronic
1086969551 11:93065920-93065942 CCAACACAGAGCTCCGGCCATGG - Intergenic
1086995749 11:93353734-93353756 CCAATGTAGAGCTTGGGCTGTGG - Intronic
1087126029 11:94626444-94626466 CCAACGTAGAGCTCAGGCCATGG - Intergenic
1087170091 11:95041315-95041337 CCAAGATAGATGGTGGGCCACGG - Intergenic
1087255571 11:95948799-95948821 CCAACATAGAGCTTGGGCTGTGG - Intergenic
1087385498 11:97463927-97463949 CCAAGGTACAGCTTGGGCTATGG + Intergenic
1087438302 11:98151039-98151061 CCAACATAGAGCTCAGACCATGG + Intergenic
1087474606 11:98620347-98620369 CCAATGTAGAGCTTGGACCATGG + Intergenic
1087496298 11:98894337-98894359 CCAATGTAGAGCTTGGGCTGTGG - Intergenic
1087668954 11:101083140-101083162 CCAAGGTACAGCTTGGGCCAGGG + Intronic
1088426965 11:109714859-109714881 CCAAAATAGAGCTTGGGCTGTGG - Intergenic
1088435247 11:109805010-109805032 CCAATATAGAGCTTGGGCTGTGG - Intergenic
1088497064 11:110441993-110442015 CCAATGTAGAGCTAGGGCCGTGG + Intronic
1088503756 11:110509399-110509421 CCAGCACAGAGCTTGGTGCATGG - Intergenic
1088550191 11:111004844-111004866 CCAGCATAGAGCCTGGCACATGG - Intergenic
1089659708 11:119977960-119977982 CCAGCACAGAGCCTGGCCCAGGG - Intergenic
1090431475 11:126650059-126650081 CCAATGTAGAGCTCAGGCCATGG - Intronic
1090692573 11:129199483-129199505 CCAAGATACAGTTTGGGCCATGG + Intronic
1090727393 11:129540117-129540139 CCAACGTAGAGCTCGGGCTGTGG - Intergenic
1091244607 11:134081480-134081502 CCAGCATAGAGCTGAGGCCATGG + Intronic
1091932081 12:4404151-4404173 CCAACATAGAGCTTGGGCCATGG + Intergenic
1092459111 12:8670963-8670985 CCAACATACAGCTTGGGCTGTGG - Intergenic
1093300063 12:17442891-17442913 CCAACATAGAGCTTGGGTCATGG + Intergenic
1093353102 12:18128134-18128156 CCAACATAGAACTTGGGTTGTGG + Intronic
1093536671 12:20231011-20231033 CCAACATAGAGCTTGAGCCATGG - Intergenic
1093682884 12:22023506-22023528 TCAAGGTACAGCTTGGGCCATGG + Intergenic
1093973924 12:25400703-25400725 CCAATGTACAGCTTGGGCCATGG + Intergenic
1094489269 12:30948549-30948571 CCAACATAAAGCTCGGGCTGTGG - Intronic
1094706053 12:32915446-32915468 CCAACGTAGAGCTTGGGCTGTGG + Intergenic
1094716176 12:33017322-33017344 CCAAGATACAGCTTGGGCTGTGG + Intergenic
1095039691 12:37427387-37427409 CCAACATAGAACTCAGGCCATGG + Intergenic
1095252606 12:39996667-39996689 CCAACATAGAGTTCGGGCCGTGG + Intronic
1095511134 12:42952835-42952857 CCAATGTAGAGCTCAGGCCATGG + Intergenic
1095928830 12:47605979-47606001 CCAACTTAGAGCTTGGGCAGTGG - Intergenic
1096257627 12:50072880-50072902 CTGAAATAGAGCTGGGGCCAGGG + Intronic
1096441804 12:51649606-51649628 CCAATGTAGAGCTCGGGCCAAGG - Intronic
1096875563 12:54627588-54627610 CCAACATAGAGCTTGGGCTGTGG + Intergenic
1096904912 12:54926567-54926589 CCAAGGTACAGGTTGGGCCATGG + Intergenic
1097141959 12:56909408-56909430 CCAAGGTACAGCTTAGGCCATGG + Intergenic
1097360497 12:58654179-58654201 CCAATGTAGAGCTCAGGCCATGG - Intronic
1097411003 12:59253028-59253050 CCAAAGTACAGCTTGGGCCATGG + Intergenic
1097481021 12:60126187-60126209 CCAAGGTAGAGCTCAGGCCATGG + Intergenic
1097498928 12:60378030-60378052 ACAAAATACAGCTTGGGCCATGG + Intergenic
1097565630 12:61265254-61265276 CCAACATAGAGCTCGAGCCATGG + Intergenic
1097999086 12:65921885-65921907 CCAACGTACAGCTTGGGCTGTGG + Intronic
1098238650 12:68443158-68443180 CTAACATATAGCTTGGGCTGTGG - Intergenic
1098486282 12:71025720-71025742 CTAACATAGAGCTTGGAACTTGG - Intergenic
1098672425 12:73248149-73248171 CCAAGGTACAGCTTGAGCCATGG - Intergenic
1098676338 12:73294304-73294326 CCAATGTAGAGCTCAGGCCATGG + Intergenic
1098743177 12:74200702-74200724 CCAAGGTAGAGCTTGTGCCATGG - Intergenic
1099004091 12:77216483-77216505 CCAATGTAGAGCTCAGGCCATGG + Intergenic
1099379702 12:81938950-81938972 CCAGTGAAGAGCTTGGGCCATGG - Intergenic
1099396500 12:82147025-82147047 CCAATGTAGAGCTCCGGCCATGG + Intergenic
1099407885 12:82285287-82285309 CCAACATAGAGCTTGGACTGTGG + Intronic
1099501445 12:83418935-83418957 CCAATGTAGAGCTTGGGCCATGG + Intergenic
1099525906 12:83719256-83719278 CCAACACAGAGCTCAGGCCATGG + Intergenic
1099700417 12:86075764-86075786 GCAACACAGAGCTTGGGCTGTGG - Intronic
1099707852 12:86180119-86180141 CCAATGTAGAGCTTGGGCTCTGG + Intronic
1099722544 12:86382742-86382764 CAGACATAGAGCTTGGGCCATGG + Intronic
1099800556 12:87451678-87451700 CCAAAGTAGAGCTTGGGCCATGG + Intergenic
1099802462 12:87474318-87474340 CCAAAGTAGAGCTTGGGCTGTGG + Intergenic
1099846180 12:88031255-88031277 CCAACATAGAGCTCGAGCTGTGG - Intronic
1099858924 12:88204970-88204992 CCAAGGTACAGCTCGGGCCATGG + Intergenic
1100348345 12:93754165-93754187 CCAAGGTAGAGCTTGGGTCATGG - Intronic
1100678444 12:96893388-96893410 CCAACATACAGCTTGGGCTGTGG + Intergenic
1100929135 12:99585780-99585802 CCAAGGTACAGCCTGGGCCATGG - Intronic
1101083753 12:101214660-101214682 CCAAGGTACAGCTTGGGCTATGG + Intergenic
1101113248 12:101506705-101506727 CCAACATAGAGCTTGGGCTGTGG + Intergenic
1101222781 12:102658150-102658172 CCAGCATAGAGCTTGGGCCGTGG - Intergenic
1101340310 12:103837181-103837203 CCAATGTAGAGCTTGGGCTGTGG - Intronic
1101359008 12:104008818-104008840 CCAACATAGGGCTTGCGCCATGG + Intronic
1101692754 12:107096773-107096795 CCAACGTACAGCTCAGGCCATGG + Intergenic
1102528651 12:113530257-113530279 CCAACATAGAGCTCGGGCCGTGG + Intergenic
1103456817 12:121074537-121074559 CCAACATACAGAATGGGGCATGG + Intergenic
1103588417 12:121973181-121973203 CCAACATAGAGCTCAGGCTGTGG + Intronic
1104240546 12:126984925-126984947 CCAATATAGAGCTAAGACCATGG - Intergenic
1105000133 12:132685604-132685626 CCATCACTGAGCTTGGGGCAGGG + Intronic
1105609452 13:21955240-21955262 CCAACACAGAGCTCAGCCCATGG - Intergenic
1105650546 13:22372357-22372379 CCAAGGTACAGCTTGGGCCATGG - Intergenic
1106048168 13:26165168-26165190 CCAACGTAGAACTTGGGACATGG + Intronic
1106610390 13:31273875-31273897 CCTACATAAAGCTAGGACCATGG - Intronic
1106917337 13:34529641-34529663 CCAACATACAGCTCGGGCTGTGG + Intergenic
1107209592 13:37837001-37837023 CCAACATAGAGCTCAGGCCATGG + Intronic
1107961925 13:45566542-45566564 CCAACATAGAGCTTGGGCCTTGG + Intronic
1108175762 13:47791049-47791071 CCAACTTAGAGCTTGGGCTGTGG + Intergenic
1108724325 13:53163720-53163742 CCAATGTAGAGCTTGGGCTGTGG - Intergenic
1108770958 13:53699974-53699996 CCAAAGTAAAGCTTGGGCCATGG + Intergenic
1108790667 13:53966228-53966250 CCAACATACAGCTTGGGCTGTGG + Intergenic
1108936803 13:55891573-55891595 CCAAGGTACAGCTCGGGCCATGG - Intergenic
1109286001 13:60409061-60409083 CCAACATATAGCTTGGGCTGTGG + Intronic
1109315060 13:60740443-60740465 CCAACATAAAGCTCAGGCTATGG - Intergenic
1109334872 13:60981306-60981328 CCAAGGTACAGCTTGGGCCACGG - Intergenic
1109407337 13:61918947-61918969 CAAACATAGAGCTCAGGCCATGG - Intergenic
1109416840 13:62051595-62051617 CCAAGGTACAGCTCGGGCCATGG + Intergenic
1109480420 13:62945300-62945322 CCAATGTAGAGCTCAGGCCATGG - Intergenic
1109522495 13:63532029-63532051 CCAACATAGAGCTCAGGCTGTGG + Intergenic
1109526305 13:63580540-63580562 CCAATATAGACCTCTGGCCATGG - Intergenic
1109702745 13:66048095-66048117 CCGATGTAGAGCTCGGGCCATGG - Intergenic
1109769510 13:66952701-66952723 CCTACACAGAGCTGGGGCCCTGG - Intronic
1109810696 13:67509306-67509328 CCAATGTAGAGCTTGGGCTGTGG + Intergenic
1110487891 13:76068140-76068162 CCAAGCTAAAGCTCGGGCCATGG + Intergenic
1110926878 13:81164717-81164739 CCAACATAGAGCTTTGGCTGTGG - Intergenic
1110989256 13:82017286-82017308 CCAACACACAGCTTGGTCAATGG - Intergenic
1111045891 13:82812709-82812731 CCATCATAGAGCTTGGGTGGTGG + Intergenic
1111083485 13:83342902-83342924 CCAACATAGAGCTCAGGCTGTGG + Intergenic
1111105748 13:83643007-83643029 CCAACATAGAGCTCAGGCCATGG - Intergenic
1111143818 13:84155848-84155870 CCAACATAGAGCTTGGGCCATGG + Intergenic
1111474115 13:88724340-88724362 CCAATATAGAGCTTGGGCTGGGG + Intergenic
1111527627 13:89492573-89492595 CCAAGGTACAGCTCGGGCCATGG - Intergenic
1111751356 13:92335296-92335318 CCAACATACTGCTTGGGCCATGG - Intronic
1111819295 13:93193967-93193989 CCAATGTAGAGTTTGAGCCATGG + Intergenic
1112744194 13:102508704-102508726 CCAAGGTACAGCTTGGCCCAGGG + Intergenic
1112769686 13:102781877-102781899 CCAAGGTACAGCTTGGGCCATGG + Intergenic
1112799338 13:103093084-103093106 CCAACGTAGAGCTCAGGACATGG - Intergenic
1112861267 13:103831451-103831473 CCAACATAGAGCTCAGGCTGTGG - Intergenic
1112887599 13:104193457-104193479 ACAACATAGAGCTAAGGTCATGG + Intergenic
1113280512 13:108782767-108782789 CCAATGTAGAGCTTGGGCCATGG + Intronic
1114380498 14:22198573-22198595 CCAACATAGAGCTCAGGCCATGG + Intergenic
1114812515 14:25917273-25917295 CCAACATAGAGCTCAGGCCATGG + Intergenic
1114936756 14:27548627-27548649 CCAAGATACAGCTCAGGCCATGG + Intergenic
1114984520 14:28210283-28210305 CCAACATAGAGCTCAGGCCATGG + Intergenic
1114986116 14:28230836-28230858 CCAACATAGAGCTGGGGCCATGG - Intergenic
1115112379 14:29839799-29839821 CCAACATAGAGCTCAGGTCATGG - Intronic
1115113660 14:29854858-29854880 CCAACAGGGAGCTTGGGCCGTGG + Intronic
1115134783 14:30095579-30095601 CCAAGGTACAGCTTGGGCCATGG + Intronic
1115199134 14:30834477-30834499 CCAAGGTACAGCTTGGGCCATGG - Intergenic
1115291188 14:31774828-31774850 CCTCCATAGAGGTTGGGCCTGGG + Intronic
1115541697 14:34427227-34427249 CAAACGTAGAGCTCAGGCCATGG + Intronic
1115820300 14:37206273-37206295 CCAATGTAGAGCTCAGGCCATGG + Intronic
1115822357 14:37225507-37225529 CCACCATAGAGCTCAGGCCATGG - Intronic
1115840303 14:37462247-37462269 CCAATGTAGAGCTCAGGCCATGG - Intronic
1115878767 14:37891798-37891820 CCAAGGTACAGCTTGGGCCATGG + Intronic
1115942206 14:38622166-38622188 CCAACCTAGAGCTCCAGCCATGG + Intergenic
1116024268 14:39496852-39496874 CCAATGTAGAGCTCAGGCCATGG + Intergenic
1116164155 14:41311832-41311854 CCAACGTACAGCTTGGGCTGTGG + Intergenic
1116275226 14:42824306-42824328 CCATCATAAAGCTCAGGCCATGG + Intergenic
1116281562 14:42914922-42914944 CCAATGTAGAGCTTGGGCCATGG - Intergenic
1116387374 14:44348222-44348244 CCAATGTAGAGCTTGGGCTGTGG + Intergenic
1116642721 14:47485739-47485761 ACAATGCAGAGCTTGGGCCATGG + Intronic
1116762084 14:49027010-49027032 TGAACGTAGAGCTCGGGCCATGG + Intergenic
1116917242 14:50537203-50537225 CCAACATAGAGCTGGGGCCGTGG + Intronic
1117084121 14:52181424-52181446 CCAAGGTACAGCTGGGGCCATGG - Intergenic
1117186273 14:53243809-53243831 CCAACACAGAGCTTGAGCTGTGG + Intergenic
1117198515 14:53364362-53364384 CCAACATACAGCTTGGGCTGTGG - Intergenic
1117427926 14:55620623-55620645 CCAAGGTACAGCATGGGCCATGG - Intronic
1118092505 14:62497836-62497858 CCAATGGACAGCTTGGGCCATGG - Intergenic
1118111012 14:62719930-62719952 CCAAAACAGAGCTTGGAACATGG - Intronic
1118494132 14:66291432-66291454 CCAACACAGAACTTATGCCATGG + Intergenic
1118598001 14:67451042-67451064 CCAACATAGAGCTCAGGCTGTGG + Intronic
1118835978 14:69478180-69478202 ACAACGTAGAGCTTGGGCCATGG - Intergenic
1119089073 14:71763515-71763537 CAAAGATAAGGCTTGGGCCAAGG - Intergenic
1119142950 14:72284435-72284457 CCAAGGTATAGCTGGGGCCATGG + Intronic
1119200543 14:72748743-72748765 CCAACATAGAGCTCAGGCTGTGG + Intronic
1120636966 14:86965014-86965036 CCAAGGTACAGCTTGGGCCATGG + Intergenic
1121166502 14:91807008-91807030 CCAAGGTACAGCTTGGGCCATGG + Intronic
1121987105 14:98517743-98517765 CTAACACAGAGCTTGGCACATGG - Intergenic
1123135162 14:106021443-106021465 CCAAGAGAGAGGCTGGGCCAGGG - Intergenic
1123159889 14:106268151-106268173 CTAACAGAGAGGATGGGCCAGGG - Intergenic
1123175167 14:106410028-106410050 CCAATAGAGAGCCTGGGCCAGGG - Intergenic
1123201945 14:106674552-106674574 CCAATAGAGAGGCTGGGCCAGGG - Intergenic
1123585708 15:21759313-21759335 CCAAGAGAGAGGCTGGGCCAGGG - Intergenic
1123622350 15:22201901-22201923 CCAAGAGAGAGGCTGGGCCAGGG - Intergenic
1124171376 15:27376621-27376643 CCAACATAAAGTTCGGGCCATGG - Intronic
1125279257 15:38026823-38026845 CCAACATAGAGCTCGGACTGTGG + Intergenic
1125453908 15:39837824-39837846 ACAACATAGTGCTTGGCTCATGG + Intronic
1125881371 15:43198871-43198893 CCAACATACCGCTTGGGCTGTGG + Intronic
1126126379 15:45298056-45298078 CCAACATAGAGCTCAGGCCGTGG + Intergenic
1126411466 15:48376883-48376905 CCAATGTAGAGCTCAGGCCATGG + Intergenic
1127145018 15:56014772-56014794 CCAACACAGAGCTTGGTCTGTGG - Intergenic
1127852692 15:62927912-62927934 CAACCACAGAGCTTGGGCCTAGG + Intergenic
1128776396 15:70323575-70323597 CCTACATAGAGCAGGGGACAGGG - Intergenic
1128813969 15:70592255-70592277 CCAAGGTACAGCTTGGGCCATGG + Intergenic
1130649298 15:85752910-85752932 CCAGCACAGAGCTTGGGCGTGGG - Intergenic
1130738951 15:86577738-86577760 CCAACATAGAGCTCGGGCCATGG + Intronic
1130847791 15:87763481-87763503 CCACCTTTGATCTTGGGCCATGG + Intergenic
1131556483 15:93404199-93404221 CCAACGTACAGCTTGGGCTGTGG + Intergenic
1131743660 15:95421487-95421509 CCAAAATAGAGCTCGGGCCATGG - Intergenic
1131767933 15:95700766-95700788 CCAGCATAGAGCTTGGGCTGTGG - Intergenic
1131980172 15:97987073-97987095 CCAACATACAGCTCTGGCTATGG + Intergenic
1132122789 15:99192460-99192482 CCATCATAGAGCTTGGGCTGTGG + Intronic
1132388161 15:101416730-101416752 CCAACGTACAGCTTGGGCTGTGG + Intronic
1134331986 16:13259709-13259731 CCAACATACGGCTTGGACCGTGG - Intergenic
1137981579 16:53074622-53074644 TCAATGTAGAGCTTGGGCCATGG + Intronic
1138550807 16:57747351-57747373 CCAACATAGAGCATGAACCAAGG - Intronic
1138859991 16:60744383-60744405 CCAACGCAGAGCTTGGGCCATGG - Intergenic
1139113420 16:63919828-63919850 CCAATGTAGAGCTCAGGCCATGG - Intergenic
1139797064 16:69491767-69491789 CCAAAGTTGAGCATGGGCCAGGG - Intergenic
1140225621 16:73074256-73074278 CCAACATTGCGCCTGGGACAGGG - Intergenic
1140316345 16:73901676-73901698 ACAACATAGAGCTTCTGGCAGGG - Intergenic
1141037828 16:80643703-80643725 CCAACATACAGCTTGGGCCATGG - Intronic
1141535617 16:84677759-84677781 CCAACAGAGGGCCTGGGTCAGGG + Intergenic
1143085937 17:4416181-4416203 CTAACCTGGAGCTGGGGCCAGGG + Intergenic
1143576420 17:7796383-7796405 CCAATAAAGAGCTTGGCTCATGG - Intronic
1143721210 17:8811188-8811210 CCAATGTAGAGCTCGGGCCATGG - Intronic
1144067541 17:11638240-11638262 CCCACATAAAGCTTGGCCAACGG - Intronic
1144538535 17:16115146-16115168 CCAAGGTACAGCTTGGGCCGTGG - Intronic
1144950851 17:18992644-18992666 CCAGCCTAGAGCTTGGGCGCCGG - Intronic
1145185006 17:20786458-20786480 GCAACATATAGTTTAGGCCAAGG + Intergenic
1145378181 17:22371062-22371084 CCAACATAGAACTCAGGCCATGG - Intergenic
1148202967 17:45762285-45762307 CCACCACAGAGCCTGAGCCAGGG - Intergenic
1148390546 17:47269050-47269072 CCAACATAGAGCTCAGGCCATGG - Intronic
1149051422 17:52309934-52309956 CCAACGTAGAGCTTGGGCTGTGG - Intergenic
1149110232 17:53019483-53019505 CCAACATACAGCTTGGGCTGTGG - Intergenic
1149135540 17:53359438-53359460 CCAGTGTATAGCTTGGGCCATGG + Intergenic
1149145819 17:53491200-53491222 CCAAAATATAGCTCAGGCCATGG - Intergenic
1149308649 17:55373184-55373206 CCAACATAGAGCTCAGGCCATGG + Intergenic
1149341112 17:55687319-55687341 CCAATATAGAGCTTGGGCCATGG + Intergenic
1149366776 17:55953029-55953051 CCAACACAGAGCTTGGGCCATGG + Intergenic
1150303502 17:64065270-64065292 CCAACATACAGAGTGGGCCTAGG + Exonic
1150523514 17:65895294-65895316 CCAGCAGAGAGCTTGGCACATGG + Intronic
1150941467 17:69698441-69698463 CCAACATACAGCTTGGACTGTGG - Intergenic
1151051554 17:70984334-70984356 CCAACGTAGAGCTTCGGCCGTGG - Intergenic
1151135822 17:71945011-71945033 CCAACATAGAACTTGGGCCATGG + Intergenic
1151501001 17:74488824-74488846 CCAACATAGAGCTTGGGCTGTGG - Intergenic
1151892660 17:76959812-76959834 ACAACAAAGAACGTGGGCCATGG + Intergenic
1152064067 17:78100477-78100499 CCAAGGTACAGTTTGGGCCATGG - Intronic
1152300800 17:79494464-79494486 CCAACAAAGCACTTGGGCCTGGG + Intronic
1152545711 17:80999201-80999223 CCCACAGAGAGTTTGGGTCACGG + Exonic
1153199323 18:2633126-2633148 CCAACGTACAGCTTGGGCTGTGG + Intergenic
1153214835 18:2809867-2809889 ACAACATAGAGCTCGGGCTGTGG - Intergenic
1153312712 18:3692872-3692894 CCAACACAGAGCTGGGACCTAGG + Intronic
1153539091 18:6135131-6135153 CCAACATAAGGCTTGGGCTATGG - Intronic
1153675747 18:7454634-7454656 CCAACAGAGAGCTTGGGGACGGG - Intergenic
1153846059 18:9050920-9050942 CCAATGTACAGCTTGGGCCATGG + Intergenic
1154049751 18:10942926-10942948 CCAACACAGAGCTTGGGCTATGG + Intronic
1154504374 18:15020868-15020890 CCAAGGTACAGCTTGGGCCATGG - Intergenic
1155675628 18:28425694-28425716 CCAACGTAGAGCTTGGGCTGTGG + Intergenic
1155679646 18:28474050-28474072 CCAATGTAGAGCTCGGGCCATGG + Intergenic
1155707855 18:28838368-28838390 CCAAGGTACAGCTTGGGCCATGG - Intergenic
1155809064 18:30208567-30208589 CCAAGGTACAGCTTGGGCCATGG - Intergenic
1156081406 18:33340669-33340691 CCAACATAGAGCTCGGGTTGTGG + Intronic
1156153047 18:34266324-34266346 CCAATACACAGCTCGGGCCATGG + Intergenic
1156265918 18:35488470-35488492 CCAAGGTAGAGCTTGGGCCACGG - Intronic
1156817512 18:41328594-41328616 CCAACATAGAGCACGGACCATGG + Intergenic
1156858861 18:41813834-41813856 CCAACATAGAGCTCAGGTCGTGG - Intergenic
1156892341 18:42204756-42204778 CCAAGGTACAGCTTGGGTCATGG + Intergenic
1157003104 18:43550502-43550524 CCAAGACAGAGCTCAGGCCACGG - Intergenic
1157408809 18:47446609-47446631 CCAATATAGAGCTCAGGCTATGG + Intergenic
1158061500 18:53348751-53348773 CCAATGTAGAGATAGGGCCATGG - Intronic
1158222048 18:55160229-55160251 CCCACATAGAGCTCGGGCTGTGG + Intergenic
1158391325 18:57047615-57047637 CCAGCACAGAGATTGGCCCAGGG + Intergenic
1159157345 18:64601509-64601531 AAAACATAGAGCTTGGGCCATGG - Intergenic
1159282930 18:66310549-66310571 CCAAGGTACAGCTTGGGCTATGG - Intergenic
1159641189 18:70864729-70864751 CCAACATAGAGCTTTGGCCATGG + Intergenic
1159650411 18:70971285-70971307 CCAAGATACAGCTCAGGCCATGG - Intergenic
1159761316 18:72430139-72430161 TCAGCATAGAGCTCGGGCCGTGG - Intergenic
1160096439 18:75877803-75877825 CCAATGTAGAGCTCAGGCCATGG + Intergenic
1161042560 19:2117729-2117751 CCAACAGTGACCATGGGCCAAGG + Intronic
1161679911 19:5674840-5674862 CCAGCATAGAGCCTGGGGTATGG - Intergenic
1163502970 19:17687237-17687259 CCAACGCAGAGCGTGGGCCTGGG + Intronic
1164447385 19:28329710-28329732 CCAATGAAGAGCCTGGGCCATGG + Intergenic
1164494829 19:28750208-28750230 CCAACATAGAGCTCAGGCCATGG - Intergenic
1164666489 19:30042297-30042319 CCAACATAGTGCTTAGGCCGTGG + Intergenic
1165703676 19:37958853-37958875 CCAATATAGAACATGGGCAAAGG + Intronic
1165888406 19:39095896-39095918 ACAACATAGAGCTTGGGCCGTGG - Intronic
1165974790 19:39666192-39666214 CCAACATAGAACTCAGGCCATGG - Intergenic
1166252749 19:41582670-41582692 CCAAGGTACAGCTGGGGCCATGG - Intronic
1166900602 19:46058771-46058793 CCAAGGTACAGCTGGGGCCATGG - Intronic
1168496196 19:56853769-56853791 CCAAGACACAGCTTGGCCCATGG + Intergenic
1168542899 19:57227809-57227831 CAAACATATAGCATGGCCCAGGG + Intergenic
924993634 2:337892-337914 CCAATGTACAGCTTGAGCCATGG + Intergenic
925494865 2:4435552-4435574 CCAAGGTACATCTTGGGCCATGG - Intergenic
925596318 2:5558726-5558748 CCAACGGACAGCTTAGGCCATGG - Intergenic
925669157 2:6293007-6293029 CCAGAGTAGAGCCTGGGCCATGG + Intergenic
926343062 2:11920797-11920819 ACAACATTGTGCTTGGGACAGGG - Intergenic
926468006 2:13215191-13215213 CCAATATAGAGTTTGGGCTGTGG - Intergenic
926868962 2:17391515-17391537 CCAAGGTACAGCTTGGGGCATGG + Intergenic
926870216 2:17407884-17407906 CCAATGTAGTGTTTGGGCCATGG + Intergenic
926919507 2:17926622-17926644 CCATGGTACAGCTTGGGCCATGG - Intronic
926929623 2:18023883-18023905 CCAAGGTACAGCTTGGGCCATGG - Intronic
926947422 2:18203456-18203478 CCAATATAGAGCTTGGGCTGTGG + Intronic
927013533 2:18931485-18931507 CCAAGAGAAAGCTGGGGCCATGG + Intergenic
927066297 2:19474380-19474402 ACAACATTGAGTTGGGGCCAAGG + Intergenic
927288287 2:21379277-21379299 CCAACATAGAGCTCAGGCTGTGG - Intergenic
927360182 2:22223789-22223811 CCAACATAGAGCTCAGGCCATGG + Intergenic
928048866 2:27968277-27968299 ACAATGTAGAGCTTGGGCCATGG + Intronic
928582830 2:32725975-32725997 CCAATGTAGAGCTTGAACCATGG - Intronic
928594257 2:32845484-32845506 CCAACATAGAGCTCAGCCCATGG + Intergenic
928731454 2:34237493-34237515 CCGATGTAGAGCTTGGGCCATGG + Intergenic
928804366 2:35132661-35132683 CCAAGGTACAGCTCGGGCCATGG - Intergenic
930006763 2:46904034-46904056 CCAACATACAGCTCGGGCTGTGG + Exonic
930076140 2:47407182-47407204 CCAACCTAGAGCTCAGGCCATGG + Intronic
930293961 2:49530302-49530324 CCAAGATAGAGCTAGGGCCATGG - Intergenic
930299189 2:49593965-49593987 CCAAAGTACAGCGTGGGCCATGG + Intergenic
930507725 2:52305294-52305316 CCAAGGTACAGCTAGGGCCATGG + Intergenic
930812901 2:55561149-55561171 CCAAGGTACAGCTTGGGCCATGG + Intronic
930960146 2:57251585-57251607 CCAAGGTACAGCTTGGGCTATGG - Intergenic
931033522 2:58211301-58211323 CCAGTGTAGAGCTTGGGCCGTGG - Intronic
931154711 2:59615043-59615065 CCAATGTAGAGCTTGGGCTGTGG - Intergenic
932552492 2:72785605-72785627 CCAATGTATAGCTTGGGCTATGG - Intronic
932821645 2:74906537-74906559 CCAACATACAGCTTGGGCTGCGG - Intergenic
932904421 2:75733899-75733921 CCAATGTACAGCTTGGGCCATGG - Intergenic
932960628 2:76408788-76408810 CCAACATAGAGCTCAGGCCATGG + Intergenic
933008264 2:77023160-77023182 CCAACATAGAGCTTGGGCTGTGG - Intronic
933064193 2:77773169-77773191 CCAATGTAGAGCTCAGGCCATGG - Intergenic
933065018 2:77781700-77781722 CCAACATAGAGCTCGGGCCATGG + Intergenic
933085095 2:78046013-78046035 CCAAGGTACAGCTCGGGCCATGG + Intergenic
933181288 2:79230352-79230374 CCAAGGTACAGCTTGGGCCGTGG + Intronic
933400914 2:81795498-81795520 CCAACATAGAGCTTGGCCTGTGG + Intergenic
933418785 2:82022449-82022471 CCAACACAGGGCTTGGGCCATGG - Intergenic
933578117 2:84092916-84092938 ACAATGTAGAGCTTGGGCCTTGG - Intergenic
934054982 2:88243922-88243944 CCAAGGTACAGCTTGGACCATGG + Intergenic
934113000 2:88759630-88759652 CCAAGATACCGCTTGGGCCGTGG + Intergenic
934636388 2:95992743-95992765 CCATCATAGGACTTGGGCGACGG - Intergenic
935130264 2:100256430-100256452 CCATCACAGAGCCTGGGCAAGGG + Intergenic
935419757 2:102854726-102854748 CCAACATAGATCTCAGGCCATGG - Intergenic
935948943 2:108311759-108311781 CCAACGTAGAGCTCAGGCCATGG + Intergenic
936592070 2:113813625-113813647 GCAAGAGAGAGCTTGTGCCAGGG - Intergenic
936788539 2:116123963-116123985 CCAAGGTACAGCTTGGCCCATGG + Intergenic
936792299 2:116164496-116164518 CCAATGTAGAGCTTGGGCTGTGG + Intergenic
936800312 2:116258014-116258036 CCAAGATACAGCTCAGGCCATGG - Intergenic
936827780 2:116602812-116602834 CCAACATAGAGCTTGGGCCATGG + Intergenic
936831842 2:116656133-116656155 CCAACATAGAGCTCAGGCTGTGG - Intergenic
937477464 2:122228114-122228136 CCAGCACAGTGCTTTGGCCAGGG + Intergenic
937730343 2:125222683-125222705 CCAAGGTAGAGCTTGGGCTGCGG - Intergenic
937751025 2:125476547-125476569 TCAACACAGAGCTTGGGCAGTGG + Intergenic
937762517 2:125622832-125622854 CCAACATAGAGCTCAAGCCATGG + Intergenic
938503562 2:131851074-131851096 CCAAGGTACAGCTTGGGCCATGG - Intergenic
938686400 2:133742301-133742323 CCAACGTAGAGCTTGGGCTGTGG - Intergenic
938868873 2:135453158-135453180 CCACTGTAGAGCTTGGGCTATGG - Intronic
939225000 2:139353769-139353791 CCAAGGTACAGCTTGAGCCATGG + Intergenic
939559292 2:143714262-143714284 CCAACGTAGAGTTTGGGCTGTGG - Intronic
939752441 2:146064160-146064182 CAAACATAGAGCTTGGGCCGTGG - Intergenic
940408776 2:153335961-153335983 CCAATGTAGAGCTTGGGCTATGG + Intergenic
940430891 2:153588510-153588532 GCAAAGTAGAGCTTGGGCCATGG - Intergenic
940542999 2:155045936-155045958 CTAACATAGAGCTCAGGCCATGG - Intergenic
940888857 2:159015283-159015305 CCAACGTAGAGCTTGGACTGTGG - Intronic
941137248 2:161733347-161733369 CCAACATAGCTCTCAGGCCATGG + Intronic
941535994 2:166722964-166722986 CCAATATGGAGCTTGGGCTGTGG - Intergenic
941560284 2:167035922-167035944 CCAACATACAGCTTGGGCTGTGG + Intronic
941570278 2:167161539-167161561 CCAACATAGAGCCTGGGCCATGG - Intronic
941967262 2:171312476-171312498 CCAAGGTACAGCTGGGGCCATGG + Intergenic
942281123 2:174364714-174364736 CCAATGTAGATCTTGGGACATGG - Intronic
942727511 2:179026353-179026375 CCAACATAGAGCTCAGGCCATGG + Intronic
942733372 2:179082877-179082899 CCAAGGTACAGCTTGGGCCATGG - Intergenic
942927960 2:181456720-181456742 CCAACAGAGAGGTTGGGTTAAGG - Intergenic
942950069 2:181712165-181712187 CCAAGGTACAGCTTGGCCCATGG + Intergenic
943205314 2:184886718-184886740 CCAACATACAGCTTGGGCTGTGG - Intronic
943219822 2:185090473-185090495 CCAATTTAGAGCTTGGGCCATGG + Intergenic
943238017 2:185347645-185347667 CCAGCAGACAGCTCGGGCCATGG + Intergenic
943386690 2:187210514-187210536 CCAATGTAGAGCTCAGGCCATGG + Intergenic
943417778 2:187630362-187630384 CCAATGTAGAGCTTGGGCCATGG + Intergenic
943511237 2:188830263-188830285 CCAACAGAGAACTCGGGCCACGG + Intergenic
943788157 2:191901385-191901407 CCAAGGTACAGCTTGGGTCATGG + Intergenic
943832877 2:192485175-192485197 TCAACATAGAGCTCAGGCCATGG + Intergenic
944101371 2:196031218-196031240 CCAACGTGGAGCTTGGGCCATGG - Intronic
944828014 2:203504401-203504423 CCAACATAGAGCTCAGGCTGTGG - Intronic
945089766 2:206168046-206168068 CCAGCGTAGAGCTTGGGCCATGG - Intergenic
945089911 2:206169018-206169040 CCAATGTAGAGCTCGGGCCATGG + Intergenic
945324931 2:208471454-208471476 CCAATGTAGAGCTTGGGCCATGG + Intronic
945618680 2:212106816-212106838 CCAAGGTAGAGCTCAGGCCATGG + Intronic
945709470 2:213278059-213278081 CCAAAGTAGAGCTTGGGCCATGG + Intergenic
945760071 2:213903451-213903473 CCAACGTAGAGCTTGGGCCATGG - Intronic
945767561 2:213999307-213999329 CCAATGTAGAGCTTGGGCTGTGG + Intronic
946108264 2:217391074-217391096 CCAATGTACAGCTCGGGCCATGG - Intronic
946562501 2:220928386-220928408 CCAACATAGAGCTTGCGCCATGG - Intergenic
946844877 2:223850403-223850425 CCAAGATACAGCTCAGGCCATGG + Intergenic
947008460 2:225538471-225538493 CCAACATAGAGCTCAGTCCATGG - Intronic
947296443 2:228635801-228635823 CCAACGTAGAGCTCGAGCCATGG - Intergenic
947345613 2:229186535-229186557 CCAACATAGAGCTTGGGCTGTGG - Intronic
947443157 2:230141012-230141034 CCAAAGTACAGCTTGGGCCATGG + Intergenic
947591280 2:231387514-231387536 CCAACAATGTGCTTGGTCCAAGG - Intergenic
947951659 2:234152883-234152905 CCAAAGTACAGCTTGGGCCATGG - Intergenic
948346532 2:237303535-237303557 CCAACATAGAGCTTGGGCCATGG + Intergenic
948580606 2:238985445-238985467 CCACCATAGAGCTGGGGCCCAGG + Intergenic
1169580247 20:7014336-7014358 CCACCACAGAGCTTGACCCAGGG - Intergenic
1169676360 20:8159289-8159311 CCAATATAGAACATGGGCCATGG - Intronic
1169766407 20:9152458-9152480 CTAACATAGAGCTTGGGCTGTGG + Intronic
1170310058 20:14982586-14982608 CCAACGCAGAGCTTGGGCCATGG + Intronic
1170313527 20:15017791-15017813 CCAACATAAAGCTTGGGCTGTGG - Intronic
1170475000 20:16706026-16706048 CCAACATAGAGCGTGGGCCATGG + Intergenic
1170499641 20:16961360-16961382 CCAACTTAGAGCTTGGGCAGTGG - Intergenic
1170522455 20:17201049-17201071 CCCACATTGAGCATGGGACATGG + Intergenic
1171130127 20:22644663-22644685 CCAATGTAGAGCTTGGGCCAAGG - Intergenic
1171167186 20:22982178-22982200 CCACAATAGCCCTTGGGCCAAGG - Intergenic
1171525095 20:25802944-25802966 CCAACATAGAACTCAGGCCATGG + Intronic
1171534279 20:25872605-25872627 ACAACATAGAACTCAGGCCATGG + Intergenic
1171551732 20:26052940-26052962 CCAACATAGAACTCAGGCCATGG - Intergenic
1171571472 20:26255494-26255516 CCAACATAGAACTCAGGCCTTGG + Intergenic
1171792853 20:29544243-29544265 ACAACATAGAACTCAGGCCACGG - Intergenic
1172200466 20:33122552-33122574 CCAACATACAGCTTGGGCTGTGG + Intergenic
1172470276 20:35188519-35188541 CCAACATAGTGCCTGGCACAAGG + Intergenic
1172720243 20:36994502-36994524 TCAATGTAGAGCTTGGGCCATGG + Intergenic
1172948026 20:38703566-38703588 CCACCATATAGGGTGGGCCAGGG - Intergenic
1173711029 20:45155879-45155901 CCAAGATACAGCTCAGGCCATGG + Intergenic
1174111779 20:48202261-48202283 CCAGCAGAGAGCCCGGGCCAGGG - Intergenic
1174169358 20:48606564-48606586 CCAGCAGAGAGCCCGGGCCAGGG + Intergenic
1174192379 20:48749492-48749514 CCAAGATAGTGCTGGGGTCAGGG + Intronic
1175625732 20:60486962-60486984 GCTTCAGAGAGCTTGGGCCATGG - Intergenic
1176427595 21:6558486-6558508 CCAGCATGGAGCTTGGCCCTGGG - Intergenic
1176657720 21:9602710-9602732 CCAAGGTACAGCTTGGGCCATGG - Intergenic
1176687292 21:9862253-9862275 CCAAGGTGCAGCTTGGGCCATGG + Intergenic
1176695976 21:9978431-9978453 ACAACATAGAGCTCAGGCTATGG + Intergenic
1177118168 21:17110166-17110188 CCAACATAGAGCTCAGGCTGTGG - Intergenic
1177204859 21:17998692-17998714 CCAACGTAGAGCTTGGGCTGTGG - Intronic
1177266998 21:18798394-18798416 CCAACCTAGAGCTCAGGCCATGG + Intergenic
1177288160 21:19077811-19077833 CCAATGTAGAGCTTGGGCCATGG + Intergenic
1177339788 21:19784012-19784034 CCAAGGTACAGCTCGGGCCATGG - Intergenic
1177479626 21:21669693-21669715 CCAAGGTAGAGCTCGGGCCATGG - Intergenic
1177504315 21:22000838-22000860 CCAACACAGAGTTTGGGCTGTGG - Intergenic
1177741126 21:25154810-25154832 CCAAGGTACAGTTTGGGCCATGG + Intergenic
1177992858 21:28059062-28059084 CCAAGGTACAGCTTCGGCCATGG + Intergenic
1179251759 21:39676564-39676586 ACAATAGAGAGGTTGGGCCAGGG - Intergenic
1179332057 21:40412964-40412986 CCAACATAGAGCTCAGGCTGTGG + Intronic
1179450171 21:41463172-41463194 CCAAAATAGAGCTTGGGCTGTGG + Intergenic
1179527916 21:41995863-41995885 CCAAGGTACAGCTTGGGCCATGG + Intronic
1179703087 21:43166803-43166825 CCAGCATGGAGCTTGGCCCTGGG - Intergenic
1180062339 21:45392006-45392028 ACAGCACAGAGCTTGTGCCAAGG - Intergenic
1180573650 22:16752498-16752520 CCAATATAGAACTCAGGCCATGG + Intergenic
1185239671 22:49735791-49735813 CCAACCTGGAGCTCCGGCCAGGG + Intergenic
949665305 3:6331895-6331917 CCAACATAGAGCTCAGGCCGTGG + Intergenic
950179049 3:10898034-10898056 CCAATGTAGAGCTCCGGCCATGG - Intronic
950412198 3:12846264-12846286 CCAAGGTACAGCTTGGGCTATGG + Intronic
950700705 3:14743796-14743818 CCAACATATAGCTTGGGCTGTGG - Intronic
950800730 3:15550172-15550194 CCAACATACAGCTCGGGCTGTGG + Intergenic
951093097 3:18598090-18598112 CCAATGTAGAGCTTGGGCCATGG - Intergenic
951203931 3:19905637-19905659 CCAATATAGAGATTTTGCCATGG + Exonic
951324562 3:21286455-21286477 CCAAGATACAGCTCGGGCCATGG + Intergenic
951446164 3:22782722-22782744 CCAAGGTACAGCTTGGGCCATGG - Intergenic
951793999 3:26517797-26517819 CCAAGGTATAGCTTAGGCCATGG + Intergenic
952185247 3:30961277-30961299 CCAACATAGAGCTCGGGCCATGG - Intergenic
952435265 3:33267180-33267202 CCAAGGTACAGCTTGGCCCATGG - Intergenic
952560424 3:34586419-34586441 CCAAAATAAACCTTGGTCCATGG + Intergenic
952691526 3:36211880-36211902 CCAAGACAGAGCTGTGGCCAGGG - Intergenic
952715096 3:36472198-36472220 CCAATGTAGAGCTTGGGCTGTGG - Intronic
952827901 3:37539251-37539273 CCAAAACAGAGCCTGGGTCAAGG + Intronic
953387718 3:42516146-42516168 CCAACCCAGAGCTTGGGGTAAGG - Intronic
953446614 3:42974076-42974098 CCAATATAGAGCTTGGGCTGTGG + Intronic
953503749 3:43462865-43462887 CCAATGTAGAGCTCAGGCCATGG + Intronic
954320698 3:49830364-49830386 CCCATATAGAGCCTGGGACATGG - Intronic
955435495 3:58894947-58894969 CCAACATAGAGCTTAGGCCATGG - Intronic
956169559 3:66421987-66422009 GCAACATAGAGCACGGACCATGG - Intronic
956363199 3:68471056-68471078 CCAACGTACAGCTCAGGCCATGG + Intronic
956474945 3:69609958-69609980 CCAATGTAGAGCTTGGGCCATGG + Intergenic
956503245 3:69910150-69910172 CCAACATAGAGCTTGGGCTATGG + Intronic
956546388 3:70408055-70408077 CCAACCTAGAGCTTGGGCCGTGG - Intergenic
956558816 3:70551175-70551197 CCAACATAGAGCTCGGGACATGG - Intergenic
956714194 3:72063759-72063781 CCAACGTAGAGCTCAGGCCATGG - Intergenic
956938606 3:74131983-74132005 CCAATATAGAGCTCAGGCTATGG - Intergenic
957300616 3:78387840-78387862 CCAACATTGAGCTCAGGCCGTGG - Intergenic
957703986 3:83755925-83755947 CCAACGTAGAGCTTGGGCCTTGG + Intergenic
957759206 3:84533122-84533144 CCAACACAGAGCTTTGGCTGTGG + Intergenic
957787448 3:84901036-84901058 TCAACACAGAGCTTAGGCCATGG + Intergenic
957935329 3:86935129-86935151 CCAACATAGAGGCTGGGCTGTGG - Intergenic
957981714 3:87519557-87519579 CCAACATAGAGCCTGGGCTGTGG + Intergenic
958018393 3:87968946-87968968 CCAAGGTACAGCTTGGGCCATGG + Intergenic
958128368 3:89386398-89386420 CCAAGGTATAGCTTGGGCCATGG + Intronic
958157325 3:89771519-89771541 CCAAGGTACAGCTTGGGCCATGG - Intergenic
958583199 3:96052609-96052631 CCAACATAGAGTTTGTGCTGTGG - Intergenic
958600333 3:96288846-96288868 CCAACATAGAGCTTGAGCTGTGG + Intergenic
958823494 3:99002795-99002817 CCAACATAAAGCTTGTGCTGTGG - Intergenic
958887186 3:99739622-99739644 CCAAGGTACAGCTTGGGCCGTGG - Intronic
959004866 3:101008693-101008715 CCAATGTAGAGCTGGGGCAATGG - Intergenic
959054442 3:101553676-101553698 CAAACAAAGAGCTTGGGCCATGG + Intergenic
959104595 3:102051634-102051656 CCAACATAGAGCTCAGGCCGTGG + Intergenic
959183193 3:103008040-103008062 CCAAGGTACAGCTTGGACCATGG - Intergenic
959233654 3:103690623-103690645 CCAATGTAGAGCTCAGGCCATGG - Intergenic
959235679 3:103718754-103718776 CCAAGGTAGAGCCTGGCCCATGG - Intergenic
959317022 3:104821879-104821901 CCAACATAGAGCTCAGGCCATGG + Intergenic
959439695 3:106360442-106360464 CCAAGGCACAGCTTGGGCCATGG + Intergenic
959624322 3:108432696-108432718 TCAACATAGAGCTTGGGTCATGG + Intronic
959730027 3:109590714-109590736 CCAACATAGAGCTCAGGCTATGG - Intergenic
959754743 3:109883863-109883885 CCAACATAGAACTCAGGACATGG - Intergenic
959915850 3:111815967-111815989 CCAACATAGAGCTTGGGCCATGG + Intronic
959968390 3:112381453-112381475 CCAACATAGAGCTCGGGCTGTGG + Intergenic
959973403 3:112431930-112431952 ACAACATAGAGCTTGGACCATGG + Intergenic
960009281 3:112815867-112815889 CCAGCAGTGAACTTGGGCCATGG - Exonic
960021803 3:112963978-112964000 CCAACATACAGCTCAGGCCATGG + Intronic
960060216 3:113312742-113312764 AAAACATAGAGGTGGGGCCATGG + Intronic
960088735 3:113617351-113617373 CCAAGAGAGAGCTGGGACCAGGG - Intronic
960439908 3:117674256-117674278 CCAAGACAGGGCTTGGGGCAGGG + Intergenic
960626533 3:119686931-119686953 CCAACATAGAGCTCAGGCCATGG - Intergenic
960842924 3:121978579-121978601 CCAACTTAGAGCTCAGGCCATGG + Intergenic
961067811 3:123891065-123891087 CCAATATAGAGCTTGGGCTGTGG - Intergenic
961568884 3:127784370-127784392 ACAATGTTGAGCTTGGGCCATGG + Intronic
961806830 3:129495622-129495644 CCAAGCTGGAGCTTGGGCCTGGG - Intronic
962045760 3:131757850-131757872 ACAACATACAGCTTGGGCTGTGG + Intronic
962440204 3:135406417-135406439 CCAACATAGAACTCGGGCTGTGG - Intergenic
962526623 3:136243261-136243283 CCAAAAGAAGGCTTGGGCCAAGG + Intergenic
962589314 3:136872776-136872798 CCAGCGTAGAGCTTGGGCTGTGG + Intronic
962769944 3:138602800-138602822 CCAACATAGAGCTTGGGCTGTGG + Intergenic
962946278 3:140173764-140173786 CCAACATAGAGCTCAGGCCATGG - Intronic
963022502 3:140885937-140885959 CCAACACAGAGCTTGGGCCATGG + Intergenic
963072842 3:141319143-141319165 CCAATGTAGAGCTTGGGCTGTGG - Intergenic
963548011 3:146685599-146685621 TCAACATAGAGCTTGGGCTGTGG - Intergenic
964088510 3:152846808-152846830 CCAATGCAGAGCTTGGGCCATGG + Intergenic
964737825 3:159934341-159934363 CCAAGATACAGCTTGGGCCATGG - Intergenic
964943577 3:162190741-162190763 CCAACATAGAGTTCTGGCTATGG + Intergenic
965013441 3:163126199-163126221 CCAATATAGAGCTCAGGCCTTGG - Intergenic
965086920 3:164111950-164111972 CCAACATACAGCTTGGGCTGTGG - Intergenic
965127527 3:164649612-164649634 GCAACGTAGAGCTCGAGCCATGG + Intergenic
965146584 3:164913019-164913041 CCAACATAGAGCTTGGGCTGTGG - Intergenic
965198632 3:165629435-165629457 CTAACATAGAGCTCAGGCCATGG - Intergenic
965203654 3:165692939-165692961 CCAACACAGAGCTTGGGCCATGG - Intergenic
965270722 3:166613977-166613999 GCAACACAGAGCTCTGGCCATGG - Intergenic
965326383 3:167309587-167309609 CCAAGATACAGCTTGGACCTTGG - Intronic
965386880 3:168056178-168056200 CCAACATAGAGCTTGGGCTATGG + Intronic
965404882 3:168255994-168256016 CCAAGGTACAGCTTGTGCCATGG - Intergenic
965458199 3:168930036-168930058 CCAGTGTAGAGCTTGGGCCATGG - Intergenic
965499997 3:169445364-169445386 CAAACATAGAGCTTGGGCTGTGG + Intronic
965838804 3:172880474-172880496 CCAAGGTACAGCTTGGGCCATGG + Intergenic
965865043 3:173195782-173195804 CCAATGTAGAGCTCAGGCCATGG + Intergenic
965931112 3:174044066-174044088 CCAAGATACAGCCTAGGCCATGG - Intronic
965932240 3:174059150-174059172 CCATCATACTGCTTGGGCCCCGG + Intronic
965968927 3:174529758-174529780 CCAACATAGAGCCTGGGTTGTGG - Intronic
966123405 3:176548102-176548124 CCAACATAGAGCTCGGGCTGTGG - Intergenic
966665060 3:182463225-182463247 CCAACATAGAGCTTGGGCCATGG + Intergenic
967155000 3:186684035-186684057 CCAATGTAGAGCTTGGGCTGTGG - Intergenic
967412517 3:189181042-189181064 CCAACATAGAGCTCAGGCCATGG - Intronic
967505261 3:190246221-190246243 CCAATGTAGAGCTGAGGCCATGG - Intergenic
967565016 3:190962612-190962634 CCAATGTAGAGCTTGGGCTGTGG + Intergenic
967633860 3:191778191-191778213 TCAAGGTACAGCTTGGGCCATGG + Intergenic
967689523 3:192457980-192458002 CCAACATAAAGCTTGGGCTGTGG + Intronic
968175912 3:196549353-196549375 CCAACATAGAGCTTGGGCTGTGG + Intergenic
968265553 3:197360355-197360377 CCAAAGTACAGCTTGGGCCATGG + Intergenic
969194616 4:5550875-5550897 CCAACATAGAGCTCAGGCTGTGG + Intronic
969993074 4:11284022-11284044 GCAATGTAGACCTTGGGCCATGG - Intergenic
970222508 4:13825308-13825330 TCAACATGGAGCTCGGGCCGTGG + Intergenic
970307976 4:14752694-14752716 CCAAGGTACAGCTTGGGCCATGG - Intergenic
970339161 4:15086333-15086355 CCAACATAGAGCTTGGGCTGTGG - Intergenic
970635541 4:18005713-18005735 CCAACATAGAGCTCGGGCCGTGG - Intronic
970659227 4:18265257-18265279 CCAACATACAGTTCGGGCCATGG - Intergenic
970683928 4:18543741-18543763 CCAGCATAAAGTCTGGGCCAGGG + Intergenic
970818932 4:20190652-20190674 CCAAGATAAAGCTCAGGCCATGG + Intergenic
970868181 4:20782565-20782587 CCAATGTAGAGCTTGGGCCAAGG - Intronic
970976513 4:22048357-22048379 CCAACATAGAGCTGGAGCCATGG - Intergenic
971069971 4:23080246-23080268 CCAAGGTACAGCTCGGGCCATGG - Intergenic
971277925 4:25215608-25215630 CCAAAGTACAGCTTGAGCCATGG - Intronic
971570469 4:28204967-28204989 CCAATGTAGAACTTGGGCCATGG - Intergenic
971668200 4:29520881-29520903 CCAACCTAGAGCTTTTGTCAAGG - Intergenic
971753305 4:30678270-30678292 CCAACATAGAACTTGGGCTGTGG + Intergenic
971815069 4:31476818-31476840 CCAACATAGAGCTCAGGCCATGG + Intergenic
971844914 4:31906338-31906360 CCAAAGTAAAGCTTGCGCCATGG - Intergenic
971857115 4:32058224-32058246 CCAAGGTATAGCTTGGGCCATGG - Intergenic
971948670 4:33315271-33315293 CCAAGGTACAGCTTGAGCCATGG + Intergenic
972100338 4:35407581-35407603 CCAACATAGAGCTCAGGCAATGG + Intergenic
972251311 4:37305130-37305152 CCAACATAGAGCTCAGGCCGTGG - Intronic
972301222 4:37787387-37787409 CCACCATAGAGCTTGGGCCATGG + Intergenic
972301823 4:37792048-37792070 CCAATGTAGAGCTCAGGCCATGG + Intergenic
972467500 4:39371239-39371261 CCAATGTAGAGCTTGGGCTGTGG + Intergenic
972582416 4:40406634-40406656 CCAATGTAGAGCTTGAGCCATGG + Intergenic
972749352 4:41973142-41973164 CCAACATAGATCTTGGACCTTGG + Intergenic
972799763 4:42462414-42462436 CCAACATAGAGTTCGGGCAGTGG + Intronic
972832683 4:42832788-42832810 CCAAAGTACAGCTTGGACCATGG + Intergenic
972844421 4:42970550-42970572 ACAAAATATAGCTTGGGACATGG - Intronic
973078617 4:45962155-45962177 CCAACATAGCACATGGGCCATGG - Intergenic
973238800 4:47934691-47934713 AGACTATAGAGCTTGGGCCAGGG + Intronic
973552375 4:52048593-52048615 CCAATGTAGAGCTCTGGCCATGG - Intergenic
973718443 4:53700518-53700540 CCAACATAGAGCTTGGGCTGTGG - Intronic
974117128 4:57592609-57592631 CACACAAAGAGCTGGGGCCATGG - Intergenic
974202804 4:58663023-58663045 CCAGTGTAGACCTTGGGCCATGG - Intergenic
974219487 4:58947977-58947999 CCAATACAGAGCTCAGGCCAAGG - Intergenic
974310990 4:60209734-60209756 CCAAAGTACAGCTTGAGCCATGG - Intergenic
974322498 4:60369341-60369363 CCAACATAGAGCTCAGGCCATGG + Intergenic
974455848 4:62128516-62128538 CCAACATAGAATTCGGGCTATGG + Intergenic
974487556 4:62524853-62524875 CCAACCTAGAGCTTGGGCTGTGG + Intergenic
974494977 4:62614991-62615013 CCAACATAGAGCTCGGGCCATGG - Intergenic
974563482 4:63553201-63553223 CCAACATACCACTTGGGCCATGG - Intergenic
974679879 4:65147036-65147058 CCAACATGGAGCTTGGGCCATGG - Intergenic
974733590 4:65900108-65900130 CCAACATAGAGCTTGGGCTGTGG + Intergenic
974748140 4:66102760-66102782 CCAAGGTACAGCTTGGACCATGG + Intergenic
974846037 4:67351941-67351963 CCAACATACAGCTTGGGCTGTGG - Intergenic
974897593 4:67957933-67957955 CCAAGCTACAGCTTGGGTCATGG + Intronic
974973321 4:68858591-68858613 TCAAGATACAGCTTGGGCCATGG + Intergenic
975216492 4:71761730-71761752 CCAATGTAGAGCTTGGGGCATGG + Intronic
975253991 4:72213146-72213168 CCAATCTAGAGCTTGGGTCATGG - Intergenic
975311999 4:72913542-72913564 CCAACGTACAGCTTGGGCTGTGG + Intergenic
975403326 4:73962254-73962276 CCAAGGTATAGTTTGGGCCATGG + Intergenic
975542905 4:75532775-75532797 CCAACATACACCTTGGGCCGTGG - Intronic
975729243 4:77321360-77321382 CCAAGGTACAGCTTGGGCCATGG - Intronic
975804330 4:78096654-78096676 CCAATGTAGAGCTCAGGCCATGG - Intronic
975942128 4:79660406-79660428 CCAATGGAGAGCTTGGACCATGG + Intergenic
976051102 4:81012339-81012361 CCAACATAGACATCAGGCCATGG + Intergenic
976259897 4:83135630-83135652 CCAACACAGAGCTCAGGCCGTGG - Intronic
976503146 4:85815035-85815057 CCAATGTAGAGCTCGGGCCATGG - Intronic
976674822 4:87692364-87692386 CCAACATAGAACTAGGGCCGTGG + Intergenic
976875624 4:89850441-89850463 CCAATGTAGAGCTTGGGTCATGG - Intergenic
977014662 4:91677877-91677899 CCAACATAGAGCTTGGGCTGTGG + Intergenic
977189121 4:93977779-93977801 CCAACAAAGAGCTCAGGCCATGG + Intergenic
977339846 4:95744335-95744357 CCAATGTAGAGCTTGGGCGATGG + Intergenic
977365994 4:96068513-96068535 CCAAGGTACTGCTTGGGCCATGG - Intergenic
977512028 4:97973734-97973756 CCAACGTAGAGCTCAGGCCGTGG + Intronic
977579046 4:98704754-98704776 CCAATGTAGAGCTTGGACCATGG + Intergenic
977592462 4:98842065-98842087 CCAACATACAGCTCGGGCAGTGG + Intergenic
977650992 4:99469308-99469330 CAAAGAGAGAGCTTGTGCCAGGG + Intergenic
977704086 4:100052169-100052191 CCAATGTAGAGCTTGGGTCACGG - Intergenic
977973050 4:103233055-103233077 CCAACATAGAGCTCAGTCCATGG + Intergenic
978101090 4:104841494-104841516 CCAACGTACAGCTTGGGCTGTGG - Intergenic
978579552 4:110218389-110218411 CCAACATATAGCTTGGGCTGTGG - Intergenic
978654756 4:111052088-111052110 CCAATGTAGAGCTCAGGCCATGG + Intergenic
978660122 4:111116094-111116116 CCAATATACAGCTTGAGCCCAGG - Intergenic
978934158 4:114355060-114355082 CCAACATAGAGCTTAGGCTGTGG - Intergenic
979063532 4:116098283-116098305 ACAACAAAGAGCTAGGGCCATGG + Intergenic
979097857 4:116573719-116573741 CCAACATAGAGCTTGGGCCATGG - Intergenic
979146150 4:117251339-117251361 GCAACGTAGAGCTTGAGCCATGG + Intergenic
979327881 4:119400239-119400261 CCAACATAGAGCTCAGGCCGTGG - Intergenic
979368028 4:119848413-119848435 CCAATGTAGAGCTTGGATCATGG - Intergenic
979405933 4:120310553-120310575 CCAACATAGAGCTCAGGCTTTGG - Intergenic
979645281 4:123060530-123060552 TCAAGGTACAGCTTGGGCCATGG - Intronic
980201313 4:129658939-129658961 CCAACGTAGAGCTCAGTCCATGG - Intergenic
980256024 4:130382022-130382044 CCAAGGTATAGCTTAGGCCATGG + Intergenic
980292437 4:130860351-130860373 CCAACTTGGAGCTTGGGCTGTGG + Intergenic
980350696 4:131680364-131680386 CCAAGGTACAGCTTGGGCCATGG + Intergenic
980368591 4:131838659-131838681 ACAACATAGAGCTCAGGCTATGG + Intergenic
980391743 4:132156053-132156075 CCAAGTTACAGCTTGGGCCATGG - Intergenic
980598520 4:134988176-134988198 CTAACATAGAGCTCAGGACATGG + Intergenic
980720416 4:136687623-136687645 CCAACATAGAGCTTGGGCCGTGG - Intergenic
980727839 4:136787822-136787844 CCAACATAGAGCTCAGACTATGG + Intergenic
980850428 4:138374380-138374402 CGAAGGTACAGCTTGGGCCACGG - Intergenic
981121014 4:141051119-141051141 CCAAGGTACAGCTTGGGCCATGG - Intronic
981308063 4:143267723-143267745 CCAATGTAGAGCTCAGGCCATGG + Intergenic
981862888 4:149378995-149379017 CCAAAGTACAGCTTGGGCCATGG + Intergenic
982019640 4:151190557-151190579 ACAACGTAGAGCTTGGGCCGTGG + Intronic
982121269 4:152145711-152145733 TCAATATAGAGCTTGGGCTGTGG - Intergenic
982192926 4:152876840-152876862 CCAATGTAGAGCTTGGGCTGTGG + Intronic
982389343 4:154847760-154847782 CCAACGTAGAGCTCAGGACATGG + Intergenic
982482970 4:155934195-155934217 CCAACATAGAGCTCAGGCTGTGG + Intronic
982524987 4:156466912-156466934 CCAAGGTACAGCTTGGGCCATGG - Intergenic
982618909 4:157678596-157678618 CCAATGTAGAGCTTGGGCCGTGG - Intergenic
982730757 4:158953307-158953329 CCAACATAGAGCTTGGGCCATGG + Intronic
982868220 4:160544176-160544198 CCAACATAGAGCTCAGGCTGTGG - Intergenic
983245633 4:165283960-165283982 CCAACATAGAGCTCAGGCCGTGG - Intronic
983340486 4:166454706-166454728 CCAACATAGCACTTAAGCCATGG + Intergenic
983460724 4:168023014-168023036 CCAAAGTAGAGCTCAGGCCATGG - Intergenic
983489168 4:168368294-168368316 CTAATGTAGAGCTTGAGCCATGG + Intronic
983657520 4:170098300-170098322 CCAAAGTACAGCTCGGGCCATGG - Intergenic
983660440 4:170126133-170126155 CCAATGTAGAGTTTGGGCCATGG + Intergenic
983723855 4:170893643-170893665 CCAATGTAGAGCTCAGGCCATGG - Intergenic
983785898 4:171729185-171729207 CCAATTTAGAGCTTGGTCCATGG + Intergenic
983812322 4:172077971-172077993 CCAAGGTACAGCTTGGGCCATGG + Intronic
983874741 4:172862984-172863006 CCAAGGTACAGCTTGGGCTATGG + Intronic
984232108 4:177112146-177112168 CCAATGTGGAGCTTGGGCTATGG - Intergenic
984386119 4:179060070-179060092 CCAGCATAGATCCTGGGCCCTGG - Intergenic
984415975 4:179459049-179459071 CCAACATAGAGCTTGGACTGTGG + Intergenic
984442540 4:179791484-179791506 CCAACATAGAGCTCAGGCCATGG + Intergenic
984553316 4:181185565-181185587 CCAAGGTACAGCTTGGGCCATGG - Intergenic
984900369 4:184580919-184580941 CCAACATAGAACTCAGGCCATGG - Intergenic
985417689 4:189753376-189753398 TCAAGGTACAGCTTGGGCCATGG + Intergenic
985617072 5:929460-929482 CCAAGGTACAACTTGGGCCATGG + Intergenic
985617780 5:934463-934485 CCAAGGTACAACTTGGGCCATGG - Intergenic
985697984 5:1352641-1352663 GCTGCATAGAGCTTGGGCCCAGG - Intergenic
986014666 5:3747530-3747552 CCAGGGTACAGCTTGGGCCATGG + Intergenic
986113945 5:4750714-4750736 CCAATATAGAGCTTGGGCTGTGG - Intergenic
986336631 5:6760260-6760282 CCAGCAGAGAGCCTGGGCCTAGG + Intergenic
986756769 5:10844053-10844075 CCAACGTACAGCTTGGGCCATGG - Intergenic
986852436 5:11829484-11829506 CCAACGTAAAGCTCAGGCCATGG + Intronic
986960352 5:13203038-13203060 CCAATGTAGAGCTCGGGCCGTGG - Intergenic
986983430 5:13474858-13474880 CCAACATAACGCTCAGGCCATGG + Intergenic
987252261 5:16111902-16111924 CCAAGGTACAGCTTGGGCCATGG + Intronic
987433545 5:17865311-17865333 CAAACATAGTGCTCAGGCCAGGG + Intergenic
987455393 5:18138570-18138592 CCAAGGTATAGCTTGGGCCTTGG - Intergenic
987464206 5:18252843-18252865 CTAATGTAGAGCTGGGGCCATGG + Intergenic
987478893 5:18428378-18428400 CCAACATAGACCTCAGACCATGG + Intergenic
987602093 5:20084768-20084790 CCAACATAGAGCTTGGGCCATGG - Intronic
987655450 5:20800285-20800307 TCAACATAGAGCTTGGGCTGTGG + Intergenic
987723101 5:21663668-21663690 CCAACATAGAGCTGGGGAGGTGG - Intergenic
987773573 5:22336567-22336589 CCAAGGTACAGCTTGGGCCATGG + Intronic
987792114 5:22581320-22581342 CCAATATAGAGCTTGGGCTGTGG + Intronic
987984885 5:25133954-25133976 CCAAGTTACAGCTTGGGCCATGG + Intergenic
988009203 5:25461689-25461711 CCAACATAGAGCTCAGGCTATGG + Intergenic
988009594 5:25465008-25465030 CCAACTTAAAGCTCAGGCCATGG + Intergenic
988138169 5:27201438-27201460 CCAAGATACAGCTTCAGCCATGG - Intergenic
988196430 5:28011613-28011635 CCAACATAAAGCTTAGGCTATGG + Intergenic
988199934 5:28054801-28054823 CCAACATAGAGCTCGGGCTGTGG - Intergenic
988471937 5:31547659-31547681 CCAACATAGAGCTCGGGCTGTGG - Intronic
988649405 5:33131759-33131781 CCAATGTAGAGCTTGGGCCATGG + Intergenic
988668950 5:33360431-33360453 CCAACATAGAGCTTGAGCTGTGG - Intergenic
988740116 5:34061651-34061673 CCAACATAGAGCTGGGGCCATGG - Intronic
988768107 5:34403617-34403639 TCAACATAGAGCTTGGGCTGTGG - Intergenic
988770455 5:34427669-34427691 CCAAGCTACGGCTTGGGCCATGG - Intergenic
988808902 5:34765945-34765967 CCAACATAGAACTTGGGCTGTGG + Intronic
989032820 5:37136791-37136813 CCAAGATACAGCTTGGGCTGTGG - Intronic
989731355 5:44654041-44654063 CCAATGTAGAGCTCAGGCCATGG - Intergenic
990193315 5:53286425-53286447 CCAACATAGAGCTTGGGCCATGG - Intergenic
990264534 5:54061219-54061241 CCAACATAGATCTCAGGCCGTGG + Intronic
990595537 5:57309315-57309337 CCAATATAGAGCTTGGGCCATGG + Intergenic
990701079 5:58475503-58475525 CCAAGGTACAGCTTGGGCCGTGG - Intergenic
990903597 5:60779516-60779538 CCAAGGTGCAGCTTGGGCCATGG - Intronic
991104940 5:62833026-62833048 CCAACATAGAGCTCGGGCCATGG - Intergenic
991409367 5:66331432-66331454 CCAAGGTACAGCTTGGGCCATGG + Intergenic
991616014 5:68497939-68497961 CCACTGTAGAGCTTGGGCCATGG + Intergenic
992138082 5:73767979-73768001 CCAACACAGAACTCGGGCCATGG + Intronic
992651564 5:78865342-78865364 CCAATGTAGAGCTTGGGCCATGG - Intronic
993015677 5:82532168-82532190 CCAAGGTACAGCTTGGGCCATGG - Intergenic
993260716 5:85655200-85655222 CCAATGTAGAGTTAGGGCCATGG + Intergenic
993293794 5:86109021-86109043 CCAATGTAGAGCCTGGGCCATGG + Intergenic
993309683 5:86313800-86313822 CCAACATACAGCTTGGGCTATGG + Intergenic
993569866 5:89524071-89524093 CCAATGTAGAGCTCAGGCCATGG - Intergenic
993723989 5:91347937-91347959 CCAACATAGAGCTCGGGCTGTGG - Intergenic
993801775 5:92351483-92351505 CCAACATAGAATTTGGGCTGTGG + Intergenic
994271523 5:97782983-97783005 CCAATGTAGAGCTCAGGCCATGG - Intergenic
994338762 5:98600855-98600877 CCAATGTATAGTTTGGGCCATGG + Intergenic
994542811 5:101121593-101121615 CCAATGCAGAGCTTGAGCCATGG - Intergenic
994614937 5:102092491-102092513 CTAACATAGAGCTTGGGCTATGG - Intergenic
994655970 5:102593481-102593503 CCAATGTAGAGCTCAGGCCATGG - Intergenic
994689543 5:102999744-102999766 CCAAGGTATAGCTTGGGCCTTGG - Intronic
994755644 5:103790549-103790571 CCAACATAGAGCTTGGTCTCTGG - Intergenic
994764524 5:103900036-103900058 CCAATGTATAGCTCGGGCCATGG + Intergenic
994895615 5:105698213-105698235 CCAACGTAGAGCTTGGACCATGG - Intergenic
994900442 5:105762830-105762852 CCAAAATAGAGCTTGGTCCATGG - Intergenic
994920094 5:106032164-106032186 CCAACGTACAGCTTGGGCTTTGG - Intergenic
995147756 5:108806141-108806163 CCAAGGTATAGCTTGGGCCATGG + Intronic
995200012 5:109415032-109415054 CCAACATAGAGCTCAGGCCATGG + Intergenic
995390969 5:111639938-111639960 CAAAGGTAGAGCCTGGGCCATGG + Intergenic
995392427 5:111653550-111653572 CCAACATACAGCTTGGGCTACGG - Intergenic
995703602 5:114962118-114962140 CCAAGGTACAGCTTGGGCCATGG - Intergenic
995925534 5:117369303-117369325 CCAAGGTACAGCTTGGGCCATGG + Intergenic
996030936 5:118703320-118703342 CCAACGTAGAGCTCAGGGCATGG - Intergenic
996033590 5:118733696-118733718 CAAACATAGAGCATGGGCCATGG + Intergenic
996098106 5:119420499-119420521 CCAAAGTATAGCTTAGGCCATGG + Intergenic
996222806 5:120953743-120953765 CCAACATGCAGCTTGGGCTGTGG + Intergenic
996247531 5:121282873-121282895 TCAAGGTAGAGCTCGGGCCATGG + Intergenic
996257798 5:121426712-121426734 CCACGGTACAGCTTGGGCCATGG - Intergenic
996967311 5:129321301-129321323 CAAAGGTAGAGATTGGGCCATGG - Intergenic
997056679 5:130452225-130452247 CCAACATACACCTTGGGCTGTGG - Intergenic
997081695 5:130746933-130746955 CCAACATAGAGCTCAGGCTGTGG + Intergenic
997116128 5:131127388-131127410 CCAACATAGAGCTTGGGCTGTGG + Intergenic
997181428 5:131832787-131832809 TGAACGCAGAGCTTGGGCCATGG - Intronic
998722972 5:144975433-144975455 CCAATGTAGAGCTTGGGCTGTGG + Intergenic
999056607 5:148584716-148584738 ACAAGATATAGTTTGGGCCAAGG + Intronic
999108000 5:149090927-149090949 CCAACACAGAGCTCAGGCCATGG + Intergenic
999541069 5:152573073-152573095 CCAAAATATAGCTTGGACCATGG + Intergenic
1000226517 5:159266774-159266796 CCAACTTACAGCTTGGGCTGTGG + Intronic
1000252585 5:159509815-159509837 CTAGCATAGAGCTTGGCACATGG + Intergenic
1000442471 5:161280287-161280309 CCAATGCAGAGCTTGGGCCATGG - Intergenic
1000648447 5:163785862-163785884 CCAATGTACAGCTTGGGCTATGG - Intergenic
1000741456 5:164974710-164974732 CCAACGTAGAGCTCAGGCCATGG + Intergenic
1001352257 5:170980553-170980575 CCAATGTAGAGCTCAGGCCACGG + Intronic
1001795498 5:174498891-174498913 CCAAAATAGAGCTCAGGCCATGG + Intergenic
1005655279 6:27929224-27929246 CCAATGTACAGCTTGGGCCATGG - Intergenic
1005816077 6:29553877-29553899 GCAACAGACAGCTCGGGCCACGG - Intergenic
1005984146 6:30860061-30860083 CCAAGGTACAGCTTGGGTCATGG - Intergenic
1006217057 6:32453473-32453495 CCAACATAGAGCTCAGGCCACGG + Intergenic
1006697124 6:35940674-35940696 CCAACATAGAGCTCGGGCTGTGG + Intergenic
1007856632 6:44864638-44864660 CCAACACAGAGCTCAGGACATGG - Intronic
1008756123 6:54797210-54797232 CCAACATAGAGCTTGGGCTGTGG + Intergenic
1009289507 6:61866363-61866385 CCGACATAGAGCTCGGACCGTGG - Intronic
1009346086 6:62614243-62614265 CAAACATAGAGCTAGGGCCATGG + Intergenic
1009396608 6:63206827-63206849 CCAATATACAGCTCAGGCCATGG + Intergenic
1009480977 6:64157642-64157664 CTAACATAGAGCTTGGGCCATGG + Intronic
1009490526 6:64284802-64284824 CCAACACAGAGCTTGGGCCATGG - Intronic
1009605120 6:65857484-65857506 CCAAGGTACAACTTGGGCCATGG - Intergenic
1009634954 6:66253326-66253348 GCAAGATAGAGCTTGGGCCATGG - Intergenic
1009772466 6:68161040-68161062 CCAATGTAGAGCTCGGGCCACGG + Intergenic
1009780319 6:68260599-68260621 CCAATGTAGAGCTTGGGCTGTGG - Intergenic
1010248360 6:73682861-73682883 CCAATGTAGAGCTCGGGCCGTGG - Intergenic
1010282587 6:74038405-74038427 CCAACATAGAGCTTTGGCCATGG + Intergenic
1010530948 6:76966706-76966728 CCAATATGGAGCTCTGGCCATGG + Intergenic
1010611856 6:77962990-77963012 CCAGTGTAGAGCTAGGGCCATGG + Intergenic
1010645853 6:78386948-78386970 CCAACATAGAGCTCAGGCCATGG - Intergenic
1010884349 6:81218052-81218074 CCAACGTAGAGCTCAGGCCCTGG + Intergenic
1010920384 6:81673279-81673301 CCAATGTAGAGCTCAGGCCATGG - Intronic
1011011199 6:82705684-82705706 CAAAGGTACAGCTTGGGCCATGG - Intergenic
1011046787 6:83093202-83093224 CAAACATAGTGCTTGGCACATGG + Intronic
1011122061 6:83964880-83964902 CCAACATGAAGCTCAGGCCATGG + Exonic
1011152537 6:84290161-84290183 CCAATGTAGAGCTCGGGCCATGG - Intergenic
1011170935 6:84503799-84503821 CCAATGTAGAGCTGGGGCCCTGG + Intergenic
1011347689 6:86389756-86389778 CCAAGGTACAGCTTTGGCCATGG + Intergenic
1011461970 6:87614230-87614252 CCAACACAAAGTTCGGGCCACGG - Intronic
1011821195 6:91255713-91255735 CCAACTTAGAGCTCAGGCCATGG + Intergenic
1011835061 6:91421389-91421411 CCAACAAAGAGCTTGGGCCATGG + Intergenic
1011883404 6:92059854-92059876 ACATAGTAGAGCTTGGGCCATGG + Intergenic
1012005410 6:93707632-93707654 CCAATGTAGAGCTCAGGCCATGG + Intergenic
1012148703 6:95718618-95718640 CCAACATAGAATCAGGGCCATGG - Intergenic
1012194195 6:96318320-96318342 CCAAGATACAGCTTAGGCCATGG - Intergenic
1012196012 6:96342145-96342167 CCAACATAGAGCTCGGGTTGTGG - Intergenic
1012239915 6:96860107-96860129 CGAATGTAGAGCTTGGGCCATGG + Intergenic
1012690773 6:102308279-102308301 CCAACATAGAGCTTGGAGTGTGG - Intergenic
1012830793 6:104201498-104201520 CCAACATAGAGGTCAGGCTATGG + Intergenic
1013077003 6:106780653-106780675 CCAATGTACAGCTCGGGCCATGG + Intergenic
1013086636 6:106863139-106863161 CCAACATAGGGCTTGGGCTGTGG + Intergenic
1013149039 6:107426235-107426257 CCAACATAAAGCTTGAGCTGTGG + Intronic
1014068156 6:117150822-117150844 CCAACATAGAGCTCAGGCTGTGG - Intergenic
1014449353 6:121565434-121565456 CCAACATAGAGCTTGGGCTGTGG + Intergenic
1014670725 6:124301183-124301205 CCAAGGTACAGCTCGGGCCATGG + Intronic
1014730975 6:125031083-125031105 CCAACATACAGCTCGGGCTGTGG - Intronic
1015351537 6:132225511-132225533 CCAAGGTACAGCTTGGGCCATGG + Intergenic
1015677111 6:135762461-135762483 CCAAGGTACAGCTTGGCCCATGG - Intergenic
1015969625 6:138730923-138730945 CCAACATAGAGTTTGGGCCGTGG - Intergenic
1016108165 6:140188449-140188471 CCAACATAGAGCTTGGGCCATGG + Intergenic
1016209001 6:141505537-141505559 CCAAGGTATAGCTTGGGCTATGG - Intergenic
1016372063 6:143385492-143385514 CCAGCTTAGAGCCTGGGCCCTGG + Intergenic
1016579703 6:145616240-145616262 CCAACATAGAGCTCAGGCCATGG + Intronic
1017525401 6:155237712-155237734 CCAACACAGAGCTTGAGCCATGG - Intronic
1017547558 6:155468386-155468408 CCAACCTACAGCTTGGGCTGTGG - Intergenic
1018032038 6:159849134-159849156 TCAGTGTAGAGCTTGGGCCATGG + Intergenic
1018040992 6:159922085-159922107 CCAACATAGAGCTTGGGACATGG + Intergenic
1018132616 6:160747208-160747230 CCATCCTAGACCTGGGGCCATGG - Intronic
1018554561 6:165036335-165036357 CCAACACAGAGCTCGGGCCATGG + Intergenic
1019098678 6:169609509-169609531 CCAACATAGAGCTCATGCCATGG - Intronic
1019150437 6:170001894-170001916 CCAACATAGAGCTCAGCCCATGG - Intergenic
1020201254 7:6081645-6081667 CCACCAGAGAGCATGCGCCATGG - Intergenic
1020585022 7:10055151-10055173 CCAAGGTACAGCTTGTGCCATGG + Intergenic
1020631859 7:10649563-10649585 CCAACATAGAGCTTGGGCTGTGG - Intergenic
1020780896 7:12516233-12516255 CCAATGTAGAGCTTGGGCAATGG + Intergenic
1020782713 7:12536338-12536360 CCAACGTAGAGCTCAGGCTATGG - Intergenic
1021036852 7:15810049-15810071 CCAAAGTAGAGCTAGGGCCATGG - Intergenic
1021529823 7:21632114-21632136 CCAACATAGAGCTCGGGACGTGG - Intronic
1021598604 7:22342203-22342225 CCAACATAGAGCTCAGGCTTTGG - Intronic
1021646760 7:22796511-22796533 CCAACATAGAGCTCAGGCCATGG - Intergenic
1022660803 7:32364844-32364866 GCAGCATGGAGCTTGGGCCCAGG + Intergenic
1023650539 7:42364489-42364511 CCAATGTAGAGATTGGGCCATGG - Intergenic
1024021444 7:45374283-45374305 CCAATGTAGAGCTTAGGCCATGG - Intergenic
1024299370 7:47875030-47875052 CCAACACAGAGCTGAGGCCCTGG + Intronic
1024438578 7:49388329-49388351 CCAACATGGAGCTCAGTCCATGG - Intergenic
1024721205 7:52139165-52139187 CCCAAGTACAGCTTGGGCCATGG - Intergenic
1024843951 7:53620411-53620433 TCAAGATACAGCTTGGGCCATGG + Intergenic
1025285762 7:57659529-57659551 CCAACATAGAACTCAGGCCATGG + Intergenic
1026120138 7:67529617-67529639 CCAACATACAGCTCGGGCTGTGG - Intergenic
1026278671 7:68902777-68902799 ACAATGTAGAGCTTGAGCCATGG + Intergenic
1027279209 7:76593518-76593540 CCAAGGTATAGCTTGGGCCATGG - Intergenic
1027549544 7:79573884-79573906 CCAACATAGAGCTTGGGCTGTGG + Intergenic
1027605368 7:80292777-80292799 CCAATGTAGAGCTTGGGCTGTGG - Intergenic
1027624743 7:80531985-80532007 CCAACATAGAGCTCGGGCCACGG + Intronic
1028126090 7:87114967-87114989 CCAATGTAGAGCTTGGGCCATGG + Intergenic
1028249714 7:88526390-88526412 CCAACAAACAGCTCGGGCTATGG - Intergenic
1028360031 7:89956131-89956153 CCAATGTAGAGCTTGGGCCATGG - Intergenic
1028624542 7:92863182-92863204 CCAACATAGAGCTCAGGCCATGG - Intergenic
1028668365 7:93372519-93372541 CCAACATAGAGCTCAGGCCGTGG - Intergenic
1028745316 7:94320574-94320596 CCAACATAGAGCTTGGGCTGTGG - Intergenic
1028790152 7:94844478-94844500 CCAAGCTACATCTTGGGCCATGG + Intergenic
1028961059 7:96750141-96750163 CCAAGGTACAGCTTGGGCCATGG - Intergenic
1029422109 7:100477222-100477244 TCAAGATAGAGGTTAGGCCAGGG + Intronic
1030144698 7:106341398-106341420 CCAACATAGAGCTCAGGCCATGG - Intergenic
1030170112 7:106592691-106592713 CTGACATAGAGTTTGTGCCAAGG - Intergenic
1030452565 7:109731227-109731249 CCAACGTAGAGCTAAGGCCATGG - Intergenic
1030784291 7:113641020-113641042 CCAATGCAGAGCTTAGGCCATGG - Intergenic
1030868756 7:114731406-114731428 CCAAAGTAGAGCTTGGGCCATGG + Intergenic
1030915164 7:115303774-115303796 CCAATGTAGACCTTGGGTCATGG + Intergenic
1031175032 7:118339063-118339085 CCAATATACAGCTTGGGCTGTGG + Intergenic
1031230179 7:119095979-119096001 CCAAGGTAGAGCTCAGGCCATGG - Intergenic
1031290485 7:119928346-119928368 CCAATATAGAGCTTGGGCTGTGG + Intergenic
1031558378 7:123206945-123206967 TCAACACACAGCTTGGGACATGG + Intergenic
1031674218 7:124589148-124589170 CCAATGTAGAGCTTGGGCTGTGG + Intergenic
1031677902 7:124633988-124634010 CCAATGTAGAGCTCAGGCCATGG + Intergenic
1031732856 7:125319886-125319908 CCAAAGTAGAGCTCGGGCCATGG + Intergenic
1031783290 7:125997463-125997485 CCAACATAGAGCTCGGGCTGTGG + Intergenic
1031791968 7:126118054-126118076 CCAAGGTACAGCTTGGGCCATGG + Intergenic
1032179222 7:129661093-129661115 CCAACACAGAGCTCGGGCCATGG - Intronic
1033456431 7:141507756-141507778 CCAACATACAGCTTGGGCTGTGG - Intergenic
1034740079 7:153465723-153465745 CCAACATAGAGCTTGAGTGATGG + Intergenic
1037178917 8:15980431-15980453 TCAACATAGACCTTGGCACATGG - Intergenic
1037243476 8:16804455-16804477 CCAAGGTAAAGCTTGGGCCATGG - Intergenic
1039657288 8:39423554-39423576 CCAACATAGAGCTCGGGCTGTGG - Intergenic
1040094842 8:43433450-43433472 CCAACATAGAGCTTCAGCCATGG + Intergenic
1040397211 8:47011327-47011349 CCAACATAAAGCTTGGTCCATGG - Intergenic
1040575400 8:48647240-48647262 TCAACATAGCGCCTGGCCCATGG + Intergenic
1041074969 8:54161064-54161086 CCAACGTAGAGCTCGGGCTGTGG + Intergenic
1041479799 8:58307331-58307353 CCGGCATAGAGCTTGGACCATGG - Intergenic
1041865794 8:62571782-62571804 CCAACATAGAGCTCAGGACAAGG - Intronic
1041984852 8:63909505-63909527 CCAACGTAGAGCTTGGGCCATGG - Intergenic
1042080618 8:65047069-65047091 CCAATGTAGAGCTTGAGCCGTGG - Intergenic
1042646092 8:70987971-70987993 CCAACGTAGAGCTCGAGCAATGG - Intergenic
1042772968 8:72398989-72399011 CCAACATACAGCTCAGGCCATGG - Intergenic
1042923097 8:73939558-73939580 CCAACATAGAGTTTGGGCCGTGG + Intronic
1043345808 8:79296681-79296703 CCAAGATACAGCTAGGGCCGTGG + Intergenic
1043834723 8:85033326-85033348 CCAACATAGAGCTTGGGCTGTGG - Intergenic
1043993117 8:86780585-86780607 CCAATGTAGAACTTAGGCCATGG + Intergenic
1044010090 8:86984141-86984163 CAAACATAGAGCTTGGGCTGTGG + Intronic
1044087215 8:87955926-87955948 CCAATGTACAGCTAGGGCCATGG - Intergenic
1044125315 8:88452323-88452345 CCAACATAGAGCTCAGGCCATGG - Intergenic
1044194069 8:89353440-89353462 CCAACCTAGAGCTCAGTCCATGG - Intergenic
1044273621 8:90275219-90275241 TCAAGGTACAGCTTGGGCCATGG + Intergenic
1044279710 8:90340948-90340970 CCAATGTACAGCTTGGGCTATGG + Intergenic
1044390616 8:91646128-91646150 CCAACAAAGAGCTAGGGCAGTGG - Intergenic
1045067218 8:98459732-98459754 CCAAGGTACAGCTCGGGCCATGG + Intronic
1045597212 8:103670172-103670194 CCAAGGTACAGCTTGGGCTATGG - Intronic
1045617906 8:103939358-103939380 CCAAGCTACAGCTTGGGCCATGG - Intronic
1045995668 8:108358961-108358983 CCAATGTACAGCTCGGGCCATGG - Intronic
1046358347 8:113117286-113117308 CCAAGGTACAGCTTGGGCCATGG + Intronic
1046368643 8:113271461-113271483 CCAAGGTACAGCTCGGGCCATGG + Intronic
1046506764 8:115146761-115146783 CCAAGGTACAACTTGGGCCATGG - Intergenic
1046530424 8:115438270-115438292 CCAACATGGTGCTGGGCCCAGGG - Intronic
1046640173 8:116721214-116721236 CCAAGATACAGCTTGGGCTGTGG + Intronic
1046689598 8:117267787-117267809 CCAAGGTACAGCTCGGGCCATGG - Intergenic
1046703244 8:117424166-117424188 CCAACATAGAGCTCAGCCCATGG - Intergenic
1047149146 8:122241213-122241235 CCAGTATAGAGCTTGGGCCATGG + Intergenic
1047535066 8:125712187-125712209 CCAATGTAGAGCTTGGGCTATGG + Intergenic
1047545636 8:125813727-125813749 CCAATGTAGAGCTTGGGCTGTGG + Intergenic
1047628041 8:126677160-126677182 CCAACGTACAGCTTGGGCTGTGG + Intergenic
1047630282 8:126699466-126699488 CCAATGTAGAGCTTGGTCTATGG + Intergenic
1047819841 8:128506758-128506780 CCAGCATAGTGCTTGGCACAGGG + Intergenic
1047941458 8:129830913-129830935 CCAACATAGAGCTCAGGTCATGG - Intergenic
1048487100 8:134858470-134858492 TCAGCAAAGAGCTTGGGACATGG + Intergenic
1048669071 8:136695983-136696005 CCAAGGTACAGCTTGGGCCATGG + Intergenic
1048699992 8:137077962-137077984 CCAACATAGAGCTTGGGCTGTGG + Intergenic
1048769712 8:137882607-137882629 CCAACATAGAGCTTGGGCCGTGG + Intergenic
1048816936 8:138342919-138342941 CTAGCATACAGCTGGGGCCATGG - Intronic
1048895791 8:138990972-138990994 CCAACATAGAGTTCAGGCCATGG - Intergenic
1048915838 8:139182023-139182045 CCAACATACAGCTCAGGCCACGG + Intergenic
1049076289 8:140399009-140399031 CCAACATACAGCTCGGGCCATGG + Intronic
1049085778 8:140477538-140477560 CCAACATAGAGCTTGGGCCGTGG - Intergenic
1049448938 8:142648479-142648501 CCAACATAGAGCTCAGGTCATGG + Intergenic
1050255602 9:3789311-3789333 CCAACATAGAGCTTGGGCTGTGG + Intergenic
1050660280 9:7876823-7876845 CCAAGGTATAGCTTGAGCCATGG + Intronic
1050805375 9:9670687-9670709 CCAACATAGAGCTCAGGCTGTGG + Intronic
1050832257 9:10029045-10029067 CCAACATAGAGCTCAGGCCATGG + Intronic
1050905084 9:10993770-10993792 CCAACATACAGCTTGGGCTGTGG + Intergenic
1050929052 9:11301264-11301286 TCAACATAGAGTTTGGGCTGTGG - Intergenic
1051089056 9:13385115-13385137 CCAACATAGAGCTCAGGCCATGG + Intergenic
1051309783 9:15757803-15757825 CCAACGTAGAGCTTGGTCCATGG + Intronic
1051369218 9:16344052-16344074 CCAGCAAAGTGCTGGGGCCAGGG - Intergenic
1051382247 9:16470633-16470655 CCAACATACAGCTTGGGCTGTGG + Intronic
1051619504 9:19036555-19036577 CCAACATAGAGCTTGGGCCATGG + Intronic
1051767464 9:20540522-20540544 CCAAGGTACAGCTTGGGCCATGG - Intronic
1051946209 9:22572904-22572926 CCAATATGGAGCTCAGGCCATGG + Intergenic
1051957437 9:22713152-22713174 CCAATGTAGAGCTTGGGCTGTGG + Intergenic
1052220644 9:26017720-26017742 CCAACATAGAGCTCAGGCTGTGG - Intergenic
1052414250 9:28157315-28157337 TCAATGTAGAGCTTGGACCATGG - Intronic
1052594110 9:30536795-30536817 TCAATACAGAGCTTGGACCATGG + Intergenic
1052595918 9:30558374-30558396 CCAACGCAGAGCTTGGGCTGTGG - Intergenic
1052846421 9:33340329-33340351 CCAACACAGAGCTTGGGCCAAGG - Intronic
1053167047 9:35852439-35852461 GTAGCTTAGAGCTTGGGCCAGGG + Intronic
1053632957 9:39964383-39964405 ACAACATAGAGCTCAGGCTATGG + Intergenic
1053772796 9:41499150-41499172 ACAACATAGAGCTCAGGCTATGG - Intergenic
1054151742 9:61611378-61611400 ACAACATAGAACTCAGGCCATGG - Intergenic
1054169962 9:61829502-61829524 CCAAGGTACAGCTTGGGCCAGGG - Intergenic
1054210931 9:62286314-62286336 ACAACATAGAGCTCAGGCTATGG - Intergenic
1054314053 9:63562540-63562562 ACAACATAGAGCTCAGGCTATGG + Intergenic
1054667576 9:67751313-67751335 CCAAGGTACAGCTTGGGCCAGGG + Intergenic
1055175595 9:73314049-73314071 CCAATGTAGAGCTCAGGCCATGG - Intergenic
1055223814 9:73969959-73969981 CCAAGGTACAACTTGGGCCATGG + Intergenic
1055264108 9:74475821-74475843 CCAATGTAGAGCTCGGGTCATGG + Intergenic
1055341915 9:75293119-75293141 CCAACATGGAGCTTGGGCCATGG - Intergenic
1055363959 9:75524740-75524762 CCCACATAGAGCTCAGGCCATGG + Intergenic
1055579319 9:77691170-77691192 CCAATGTAGACCTTGGGCTATGG - Intergenic
1055713348 9:79089131-79089153 CCAAAGTACAGCTTGGGCCATGG - Intergenic
1055878457 9:80970664-80970686 CCATTATAGAGCTCGGGCCATGG + Intergenic
1055968192 9:81885642-81885664 CCAACACAGAGCTAAGGCCAAGG - Intergenic
1056012448 9:82346319-82346341 CCAACGTAGAGCTCAAGCCATGG + Intergenic
1056087037 9:83160862-83160884 CCCACATAGAGCTTGGGTCGTGG + Intergenic
1056595141 9:88001900-88001922 CCACCATAGAGCTCCAGCCATGG + Intergenic
1056639376 9:88357594-88357616 CCAACATAGAGCTCAGGCTGTGG + Intergenic
1057542433 9:95987992-95988014 CCAAGGTACAGCTTGGGCCATGG - Intronic
1058065663 9:100545395-100545417 CCAATGTAGAGCTTGGGCTGTGG - Intronic
1058076515 9:100657149-100657171 CCAACGTAGAGCTTGGGCTGTGG + Intergenic
1058082253 9:100712599-100712621 CCAACATAGAGCTCAGGCCGTGG - Intergenic
1058174516 9:101722161-101722183 CCAACATAGAGCTCAGGCTGTGG + Intronic
1058221962 9:102313904-102313926 CCAAGATATAGCTTGGGTCGTGG + Intergenic
1058292240 9:103257008-103257030 CCAAGGTACAGCTTGAGCCATGG - Intergenic
1058380436 9:104371714-104371736 CCAATATAGAGCTCGAACCATGG + Intergenic
1058401533 9:104625185-104625207 CCAATGCAGAGCTCGGGCCATGG + Intergenic
1058716326 9:107725467-107725489 GCAACAAAGAGGTTAGGCCAAGG + Intergenic
1059195393 9:112366499-112366521 CCAATATAGAGCTTGGGCCATGG + Intergenic
1059562441 9:115348214-115348236 CCAATGTAGAGCTTGGGCTATGG - Intronic
1060311932 9:122470297-122470319 CCAACATAGAGCTCAGGCCATGG + Intergenic
1060451889 9:123750489-123750511 TGAACATAGAGGATGGGCCAGGG - Intronic
1061070827 9:128309576-128309598 CCAAGGTAGAGCTCGGGCCCTGG + Exonic
1062574230 9:137199131-137199153 CCAACAGGGAGCCTCGGCCACGG - Exonic
1062616957 9:137401664-137401686 CCAACATAGAGCTCGGGCTGTGG - Intronic
1203635448 Un_KI270750v1:106284-106306 CCAAGGTACAGCTTGGGCCATGG - Intergenic
1186222713 X:7366556-7366578 CTAACCTAGAGCTCTGGCCATGG + Intergenic
1186266647 X:7840720-7840742 CCAACGTACAGCTTGGGCTGTGG - Intergenic
1186742597 X:12534133-12534155 CCAATGTAGAGCTTGGGCTGTGG + Intronic
1186797666 X:13062413-13062435 CCAACATAGAGCTTGGGCCATGG - Intergenic
1186954740 X:14669636-14669658 CCAACATAGAGCTCAGGCTGTGG - Intronic
1187070132 X:15879686-15879708 CCACGGTACAGCTTGGGCCATGG - Intergenic
1187619156 X:21030840-21030862 CCAAGGTACAGCTTTGGCCATGG - Intergenic
1187663223 X:21573622-21573644 CCAAGGTATAGGTTGGGCCATGG - Intronic
1188624316 X:32265246-32265268 CCAAGATAGAGCTCAGCCCATGG + Intronic
1188731185 X:33648098-33648120 CCAAGGTACAGCTTGAGCCATGG - Intergenic
1188753836 X:33936207-33936229 CCAACATAGAGCTCTGGCCATGG - Intergenic
1188785105 X:34336240-34336262 CCAACATAGAGCTTGGGCTGTGG - Intergenic
1188794227 X:34442161-34442183 CTGACATAGAGCTCAGGCCATGG - Intergenic
1188804511 X:34570558-34570580 CCAATGTAGAGCTTGAGCCATGG - Intergenic
1189097796 X:38158509-38158531 CTAGCATAGAGCTTGGCACATGG - Intronic
1189371273 X:40431464-40431486 CCAATGTAGAGCTTGGGCTGTGG + Intergenic
1189637213 X:43023700-43023722 CCAACATAGAGCTCAGGCTATGG - Intergenic
1190513300 X:51195777-51195799 CCAACATAGAGCTTGGGCCATGG - Intergenic
1191084062 X:56545751-56545773 CCAAGGTACAGCTTGGGCCATGG - Intergenic
1191188565 X:57640141-57640163 GCAATGTGGAGCTTGGGCCATGG + Intergenic
1191211469 X:57889492-57889514 CCAAGGTACAGCTCGGGCCATGG - Intergenic
1192162453 X:68798681-68798703 CCAATGTAGAGCTCAGGCCATGG + Intergenic
1192270560 X:69575420-69575442 CCAACATAGAGCTTGGGCCATGG - Intergenic
1192713595 X:73616711-73616733 CCAAGGTACAGCTTGGGCCATGG - Intronic
1192841915 X:74865742-74865764 CTAAAGTACAGCTTGGGCCATGG + Intronic
1192846270 X:74909833-74909855 CCAACGTACAGCTCGGCCCATGG + Intronic
1192856557 X:75018313-75018335 CCAACACAGAGCTTTGGCTGTGG - Intergenic
1192932840 X:75825993-75826015 CCAAAGTACAGCATGGGCCATGG - Intergenic
1193183298 X:78483576-78483598 CCAAAGTACAGTTTGGGCCACGG - Intergenic
1193226448 X:78989638-78989660 CCAATGTAGAACTTGGGCCATGG + Intergenic
1193307953 X:79972146-79972168 CAAACATAGAGCTCAGGCCATGG + Intergenic
1193422095 X:81294393-81294415 CCAAAGTACAGCTTGTGCCATGG + Intronic
1193662522 X:84274429-84274451 CCAATGTAGATCTTGGGCCATGG - Intergenic
1193707894 X:84844999-84845021 CAAATGTAGAGCTTGGGTCATGG - Intergenic
1193711323 X:84883927-84883949 CAAATGTAGAGCTTGGGTCATGG + Intergenic
1193797208 X:85891480-85891502 CCAACATAGAGCTCAGGCTGTGG + Intronic
1193842044 X:86418532-86418554 CCAACATAGAGCTGGGACCATGG - Intronic
1193845636 X:86466827-86466849 CCAACGTAGAGCTGGGGACGTGG - Intronic
1194089086 X:89563702-89563724 CCAACATATAGCTCAGGCCGTGG - Intergenic
1194215804 X:91129049-91129071 CCAACATAGAGCTTGGGCTGTGG - Intergenic
1194220450 X:91183244-91183266 CCAACATAGAGCTCAGGCTGTGG + Intergenic
1194256907 X:91646092-91646114 CCAACATAGAGTTTGGGCCATGG + Intergenic
1194264517 X:91738448-91738470 CCAATGTACAGCTTGGGCCATGG + Intergenic
1194288332 X:92038394-92038416 CCAACATGGAACTCAGGCCATGG + Intronic
1194297373 X:92143477-92143499 CCAACGTAGAGCTTGGGCTGTGG + Intronic
1194320597 X:92441511-92441533 CCAAGGTAGAGTTTGGGCCATGG + Intronic
1194330936 X:92582384-92582406 CCAAGATACAGCTTTGGCCATGG + Intronic
1194364402 X:92996298-92996320 CCAACATAGAGCTTGGACTGTGG + Intergenic
1194389610 X:93299991-93300013 ACAAGGTATAGCTTGGGCCATGG + Intergenic
1194397550 X:93404196-93404218 CCAACGTACAACTTAGGCCATGG - Intergenic
1194484495 X:94471152-94471174 CCAGTATAGAGCTTGGGCCGTGG + Intergenic
1194662101 X:96639081-96639103 CCAACATAGAGCTTGGGCCGTGG + Intergenic
1194828972 X:98597141-98597163 CCAACATACAGCTTGGGCTGTGG - Intergenic
1194876952 X:99201166-99201188 CCAACATAGAGCATGGGCTGTGG + Intergenic
1195154533 X:102109945-102109967 CTAAGGTACAGCTTGGGCCATGG + Intergenic
1195196074 X:102499036-102499058 TCAATGTACAGCTTGGGCCATGG + Intergenic
1195210098 X:102646241-102646263 CCAACATACAGCTTGGGCTGTGG - Intergenic
1195815285 X:108878365-108878387 CCAAGGTACAGCTTGGGCCATGG - Intergenic
1195863701 X:109407716-109407738 CCAACATAAAGCTTGGGCTGTGG + Intronic
1196223577 X:113139452-113139474 CCAAGATACAGCTTGGGCCATGG - Intergenic
1196391323 X:115210349-115210371 CCAAGGTACAGCTTGGGCCGTGG + Intronic
1196540403 X:116900549-116900571 CCAACATATAGCTCGGACCGTGG - Intergenic
1196543290 X:116934446-116934468 CCAATATAGAGCTCAGGCCATGG + Intergenic
1196559298 X:117126550-117126572 ACAACATAGAGCTTGGGCCATGG + Intergenic
1196973885 X:121138042-121138064 ACAACATAGAGCTCAGGCCATGG - Intergenic
1197023483 X:121718208-121718230 TCAAGATACAGCTTGAGCCACGG - Intergenic
1197061330 X:122184866-122184888 CCAACATAGAGCTTGGGCTGTGG - Intergenic
1197092554 X:122556168-122556190 CCAATGTAGAGCTCAGGCCATGG + Intergenic
1197202324 X:123759039-123759061 CCAAGGTACAGCTTGGGCCATGG + Intergenic
1197341011 X:125266440-125266462 CTAATGTAGAGCTCGGGCCATGG + Intergenic
1197348949 X:125359093-125359115 CCAGTGTAGAGCTTGGGCCATGG + Intergenic
1197442854 X:126512034-126512056 CCAAAGTACAGCTTGGGCCATGG - Intergenic
1197510232 X:127361808-127361830 CCAAGGTACAGCTTAGGCCATGG - Intergenic
1197534233 X:127667118-127667140 CCAAAGTACAGGTTGGGCCATGG + Intergenic
1197560545 X:128015097-128015119 CCAAGGTACAGCTCGGGCCATGG - Intergenic
1198569760 X:137942306-137942328 CCAACATGGAGCTTGGGCCATGG + Intergenic
1198734602 X:139772152-139772174 CCAACGTAGAGCTTAGGCCATGG + Intronic
1198857490 X:141033397-141033419 CCAACACAGAGCTCAGGCCGTGG + Intergenic
1198905206 X:141553974-141553996 CCAACACAGAGCTCAGGCCGTGG - Intergenic
1199580761 X:149357858-149357880 CCAAGGTACAGCTTGGGCCATGG + Intergenic
1199820798 X:151443537-151443559 CCAACATAGAGCTCGGGCTGTGG + Intergenic
1199869773 X:151888029-151888051 CCAAGGTACAGCTTGGGCCGTGG + Intergenic
1200441754 Y:3219752-3219774 CCAACATATAGCTCAGGCCGTGG - Intergenic
1200556962 Y:4646996-4647018 CCAACATAGAGCTCAGGCTGTGG + Intergenic
1200575626 Y:4885359-4885381 CCAACATAGAGTTTGGGCCATGG + Intergenic
1200605855 Y:5262959-5262981 CCAACATGGAACTCAGGCCATGG + Intronic
1200614944 Y:5368378-5368400 CCAACGTAGAGCTTGGGCTGTGG + Intronic
1200628712 Y:5554646-5554668 CCAAGGTAGAGGTTGGGCCATGG + Intronic
1200639640 Y:5701450-5701472 CCAAGATACAGCTTTGGCCATGG + Intronic
1200672633 Y:6112563-6112585 CCAACATAGAGCTTGGACTGTGG + Intergenic
1201402803 Y:13621190-13621212 CCAACATACAGCTAAGGCCATGG - Intergenic
1201452240 Y:14129100-14129122 CTAACATAGAGCTTGGGCTGTGG + Intergenic
1201590033 Y:15604521-15604543 CAAAAGTACAGCTTGGGCCATGG - Intergenic