ID: 966665061

View in Genome Browser
Species Human (GRCh38)
Location 3:182463234-182463256
Sequence AGCTTGGGCCATGGCTTCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 3925
Summary {0: 104, 1: 314, 2: 756, 3: 1216, 4: 1535}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966665052_966665061 11 Left 966665052 3:182463200-182463222 CCGCTCCACTCATGGCTGAAAGG No data
Right 966665061 3:182463234-182463256 AGCTTGGGCCATGGCTTCAGAGG 0: 104
1: 314
2: 756
3: 1216
4: 1535
966665048_966665061 24 Left 966665048 3:182463187-182463209 CCTTGCATCCCAGCCGCTCCACT No data
Right 966665061 3:182463234-182463256 AGCTTGGGCCATGGCTTCAGAGG 0: 104
1: 314
2: 756
3: 1216
4: 1535
966665051_966665061 15 Left 966665051 3:182463196-182463218 CCAGCCGCTCCACTCATGGCTGA No data
Right 966665061 3:182463234-182463256 AGCTTGGGCCATGGCTTCAGAGG 0: 104
1: 314
2: 756
3: 1216
4: 1535
966665056_966665061 6 Left 966665056 3:182463205-182463227 CCACTCATGGCTGAAAGGGGCCA No data
Right 966665061 3:182463234-182463256 AGCTTGGGCCATGGCTTCAGAGG 0: 104
1: 314
2: 756
3: 1216
4: 1535
966665050_966665061 16 Left 966665050 3:182463195-182463217 CCCAGCCGCTCCACTCATGGCTG No data
Right 966665061 3:182463234-182463256 AGCTTGGGCCATGGCTTCAGAGG 0: 104
1: 314
2: 756
3: 1216
4: 1535

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966665061 Original CRISPR AGCTTGGGCCATGGCTTCAG AGG Intergenic
Too many off-targets to display for this crispr