ID: 966665062

View in Genome Browser
Species Human (GRCh38)
Location 3:182463235-182463257
Sequence GCTTGGGCCATGGCTTCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 4231
Summary {0: 110, 1: 317, 2: 720, 3: 1144, 4: 1940}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966665052_966665062 12 Left 966665052 3:182463200-182463222 CCGCTCCACTCATGGCTGAAAGG No data
Right 966665062 3:182463235-182463257 GCTTGGGCCATGGCTTCAGAGGG 0: 110
1: 317
2: 720
3: 1144
4: 1940
966665056_966665062 7 Left 966665056 3:182463205-182463227 CCACTCATGGCTGAAAGGGGCCA No data
Right 966665062 3:182463235-182463257 GCTTGGGCCATGGCTTCAGAGGG 0: 110
1: 317
2: 720
3: 1144
4: 1940
966665051_966665062 16 Left 966665051 3:182463196-182463218 CCAGCCGCTCCACTCATGGCTGA No data
Right 966665062 3:182463235-182463257 GCTTGGGCCATGGCTTCAGAGGG 0: 110
1: 317
2: 720
3: 1144
4: 1940
966665050_966665062 17 Left 966665050 3:182463195-182463217 CCCAGCCGCTCCACTCATGGCTG No data
Right 966665062 3:182463235-182463257 GCTTGGGCCATGGCTTCAGAGGG 0: 110
1: 317
2: 720
3: 1144
4: 1940
966665048_966665062 25 Left 966665048 3:182463187-182463209 CCTTGCATCCCAGCCGCTCCACT No data
Right 966665062 3:182463235-182463257 GCTTGGGCCATGGCTTCAGAGGG 0: 110
1: 317
2: 720
3: 1144
4: 1940

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966665062 Original CRISPR GCTTGGGCCATGGCTTCAGA GGG Intergenic
Too many off-targets to display for this crispr