ID: 966680295

View in Genome Browser
Species Human (GRCh38)
Location 3:182634818-182634840
Sequence AAGAAGAAGGAGAAGGAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966680289_966680295 29 Left 966680289 3:182634766-182634788 CCACACTGCACTCCAGCCTGGGC 0: 1296
1: 2586
2: 2572
3: 1802
4: 1639
Right 966680295 3:182634818-182634840 AAGAAGAAGGAGAAGGAGAAGGG No data
966680291_966680295 13 Left 966680291 3:182634782-182634804 CCTGGGCAACAAAGTGAGACTCT 0: 438
1: 10611
2: 46228
3: 112951
4: 203960
Right 966680295 3:182634818-182634840 AAGAAGAAGGAGAAGGAGAAGGG No data
966680290_966680295 17 Left 966680290 3:182634778-182634800 CCAGCCTGGGCAACAAAGTGAGA 0: 2291
1: 39001
2: 98206
3: 211750
4: 329342
Right 966680295 3:182634818-182634840 AAGAAGAAGGAGAAGGAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966680295 Original CRISPR AAGAAGAAGGAGAAGGAGAA GGG Intergenic
No off target data available for this crispr