ID: 966681213

View in Genome Browser
Species Human (GRCh38)
Location 3:182643798-182643820
Sequence GAGCCCTCTGGGCTTCATTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966681207_966681213 11 Left 966681207 3:182643764-182643786 CCTCCAAGGACAAGCATCACAAT No data
Right 966681213 3:182643798-182643820 GAGCCCTCTGGGCTTCATTCTGG No data
966681205_966681213 30 Left 966681205 3:182643745-182643767 CCAAGGACAAAAGCTAAAACCTC No data
Right 966681213 3:182643798-182643820 GAGCCCTCTGGGCTTCATTCTGG No data
966681208_966681213 8 Left 966681208 3:182643767-182643789 CCAAGGACAAGCATCACAATCCA No data
Right 966681213 3:182643798-182643820 GAGCCCTCTGGGCTTCATTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966681213 Original CRISPR GAGCCCTCTGGGCTTCATTC TGG Intergenic
No off target data available for this crispr