ID: 966681997

View in Genome Browser
Species Human (GRCh38)
Location 3:182651665-182651687
Sequence AAATCCTGTTGCACTAAGAT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966681997_966682003 17 Left 966681997 3:182651665-182651687 CCGATCTTAGTGCAACAGGATTT No data
Right 966682003 3:182651705-182651727 ACTGGAACAAAGACGCAAAAAGG No data
966681997_966681999 -1 Left 966681997 3:182651665-182651687 CCGATCTTAGTGCAACAGGATTT No data
Right 966681999 3:182651687-182651709 TGCCAGTGGACCATATCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966681997 Original CRISPR AAATCCTGTTGCACTAAGAT CGG (reversed) Intergenic