ID: 966681999

View in Genome Browser
Species Human (GRCh38)
Location 3:182651687-182651709
Sequence TGCCAGTGGACCATATCCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966681997_966681999 -1 Left 966681997 3:182651665-182651687 CCGATCTTAGTGCAACAGGATTT No data
Right 966681999 3:182651687-182651709 TGCCAGTGGACCATATCCACTGG No data
966681996_966681999 2 Left 966681996 3:182651662-182651684 CCTCCGATCTTAGTGCAACAGGA No data
Right 966681999 3:182651687-182651709 TGCCAGTGGACCATATCCACTGG No data
966681994_966681999 3 Left 966681994 3:182651661-182651683 CCCTCCGATCTTAGTGCAACAGG No data
Right 966681999 3:182651687-182651709 TGCCAGTGGACCATATCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966681999 Original CRISPR TGCCAGTGGACCATATCCAC TGG Intergenic