ID: 966682003

View in Genome Browser
Species Human (GRCh38)
Location 3:182651705-182651727
Sequence ACTGGAACAAAGACGCAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966682000_966682003 -7 Left 966682000 3:182651689-182651711 CCAGTGGACCATATCCACTGGAA No data
Right 966682003 3:182651705-182651727 ACTGGAACAAAGACGCAAAAAGG No data
966681994_966682003 21 Left 966681994 3:182651661-182651683 CCCTCCGATCTTAGTGCAACAGG No data
Right 966682003 3:182651705-182651727 ACTGGAACAAAGACGCAAAAAGG No data
966681997_966682003 17 Left 966681997 3:182651665-182651687 CCGATCTTAGTGCAACAGGATTT No data
Right 966682003 3:182651705-182651727 ACTGGAACAAAGACGCAAAAAGG No data
966681996_966682003 20 Left 966681996 3:182651662-182651684 CCTCCGATCTTAGTGCAACAGGA No data
Right 966682003 3:182651705-182651727 ACTGGAACAAAGACGCAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966682003 Original CRISPR ACTGGAACAAAGACGCAAAA AGG Intergenic