ID: 966683286

View in Genome Browser
Species Human (GRCh38)
Location 3:182666484-182666506
Sequence CGGGGTTTTACCGGTTAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966683286_966683292 8 Left 966683286 3:182666484-182666506 CCTGGCTAACCGGTAAAACCCCG No data
Right 966683292 3:182666515-182666537 AAAAATACAAAAAATTAGCTGGG 0: 19594
1: 68711
2: 45259
3: 39801
4: 74226
966683286_966683293 13 Left 966683286 3:182666484-182666506 CCTGGCTAACCGGTAAAACCCCG No data
Right 966683293 3:182666520-182666542 TACAAAAAATTAGCTGGGCGTGG 0: 7863
1: 33095
2: 44555
3: 58584
4: 93502
966683286_966683296 20 Left 966683286 3:182666484-182666506 CCTGGCTAACCGGTAAAACCCCG No data
Right 966683296 3:182666527-182666549 AATTAGCTGGGCGTGGTGGCGGG 0: 10174
1: 43081
2: 75581
3: 71688
4: 48204
966683286_966683294 16 Left 966683286 3:182666484-182666506 CCTGGCTAACCGGTAAAACCCCG No data
Right 966683294 3:182666523-182666545 AAAAAATTAGCTGGGCGTGGTGG 0: 12832
1: 74490
2: 167805
3: 193889
4: 182442
966683286_966683291 7 Left 966683286 3:182666484-182666506 CCTGGCTAACCGGTAAAACCCCG No data
Right 966683291 3:182666514-182666536 TAAAAATACAAAAAATTAGCTGG 0: 46378
1: 32102
2: 17348
3: 25338
4: 125991
966683286_966683295 19 Left 966683286 3:182666484-182666506 CCTGGCTAACCGGTAAAACCCCG No data
Right 966683295 3:182666526-182666548 AAATTAGCTGGGCGTGGTGGCGG 0: 10244
1: 39956
2: 61717
3: 51309
4: 28030

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966683286 Original CRISPR CGGGGTTTTACCGGTTAGCC AGG (reversed) Intergenic
No off target data available for this crispr