ID: 966685253

View in Genome Browser
Species Human (GRCh38)
Location 3:182686486-182686508
Sequence CAGGATCTACTTGTTTTTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966685253_966685258 15 Left 966685253 3:182686486-182686508 CCCTCAAAAACAAGTAGATCCTG No data
Right 966685258 3:182686524-182686546 ATTTCATTTCTGAATTAGTAAGG No data
966685253_966685260 22 Left 966685253 3:182686486-182686508 CCCTCAAAAACAAGTAGATCCTG No data
Right 966685260 3:182686531-182686553 TTCTGAATTAGTAAGGACAAGGG No data
966685253_966685259 21 Left 966685253 3:182686486-182686508 CCCTCAAAAACAAGTAGATCCTG No data
Right 966685259 3:182686530-182686552 TTTCTGAATTAGTAAGGACAAGG No data
966685253_966685261 23 Left 966685253 3:182686486-182686508 CCCTCAAAAACAAGTAGATCCTG No data
Right 966685261 3:182686532-182686554 TCTGAATTAGTAAGGACAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966685253 Original CRISPR CAGGATCTACTTGTTTTTGA GGG (reversed) Intergenic
No off target data available for this crispr