ID: 966686402

View in Genome Browser
Species Human (GRCh38)
Location 3:182700493-182700515
Sequence ATGCCCATTCAGAAGTGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966686400_966686402 8 Left 966686400 3:182700462-182700484 CCAAATCATGGAAAAATAGACCT No data
Right 966686402 3:182700493-182700515 ATGCCCATTCAGAAGTGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966686402 Original CRISPR ATGCCCATTCAGAAGTGTGA AGG Intergenic
No off target data available for this crispr