ID: 966688917

View in Genome Browser
Species Human (GRCh38)
Location 3:182724296-182724318
Sequence ACCAGAGGACCTAATCAATG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966688911_966688917 -9 Left 966688911 3:182724282-182724304 CCCCCAAATGTGGTACCAGAGGA No data
Right 966688917 3:182724296-182724318 ACCAGAGGACCTAATCAATGGGG No data
966688907_966688917 10 Left 966688907 3:182724263-182724285 CCCATGGTTGCAGGCGTGACCCC No data
Right 966688917 3:182724296-182724318 ACCAGAGGACCTAATCAATGGGG No data
966688902_966688917 30 Left 966688902 3:182724243-182724265 CCTGGCACCATAATTGGTACCCC No data
Right 966688917 3:182724296-182724318 ACCAGAGGACCTAATCAATGGGG No data
966688912_966688917 -10 Left 966688912 3:182724283-182724305 CCCCAAATGTGGTACCAGAGGAC No data
Right 966688917 3:182724296-182724318 ACCAGAGGACCTAATCAATGGGG No data
966688908_966688917 9 Left 966688908 3:182724264-182724286 CCATGGTTGCAGGCGTGACCCCC No data
Right 966688917 3:182724296-182724318 ACCAGAGGACCTAATCAATGGGG No data
966688906_966688917 11 Left 966688906 3:182724262-182724284 CCCCATGGTTGCAGGCGTGACCC No data
Right 966688917 3:182724296-182724318 ACCAGAGGACCTAATCAATGGGG No data
966688904_966688917 23 Left 966688904 3:182724250-182724272 CCATAATTGGTACCCCATGGTTG No data
Right 966688917 3:182724296-182724318 ACCAGAGGACCTAATCAATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966688917 Original CRISPR ACCAGAGGACCTAATCAATG GGG Intergenic
No off target data available for this crispr