ID: 966690185

View in Genome Browser
Species Human (GRCh38)
Location 3:182733487-182733509
Sequence GGTAAGGAAGAATCGACTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966690185_966690189 11 Left 966690185 3:182733487-182733509 CCAGCAGTCGATTCTTCCTTACC No data
Right 966690189 3:182733521-182733543 ACTCCTAGCCACCAACCCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966690185 Original CRISPR GGTAAGGAAGAATCGACTGC TGG (reversed) Intergenic
No off target data available for this crispr