ID: 966691317

View in Genome Browser
Species Human (GRCh38)
Location 3:182744535-182744557
Sequence AAACATATGACCATACTGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966691316_966691317 24 Left 966691316 3:182744488-182744510 CCAAATAAATCTATTATGGCTAA No data
Right 966691317 3:182744535-182744557 AAACATATGACCATACTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966691317 Original CRISPR AAACATATGACCATACTGCC AGG Intergenic
No off target data available for this crispr