ID: 966692483

View in Genome Browser
Species Human (GRCh38)
Location 3:182756131-182756153
Sequence GTCTGGATAGTTTTTGAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966692477_966692483 20 Left 966692477 3:182756088-182756110 CCCCAAGTTAAAAAACCTCTCTG No data
Right 966692483 3:182756131-182756153 GTCTGGATAGTTTTTGAGACAGG No data
966692476_966692483 30 Left 966692476 3:182756078-182756100 CCTTATAAAACCCCAAGTTAAAA No data
Right 966692483 3:182756131-182756153 GTCTGGATAGTTTTTGAGACAGG No data
966692481_966692483 5 Left 966692481 3:182756103-182756125 CCTCTCTGAGCAATTGGCATAGA No data
Right 966692483 3:182756131-182756153 GTCTGGATAGTTTTTGAGACAGG No data
966692478_966692483 19 Left 966692478 3:182756089-182756111 CCCAAGTTAAAAAACCTCTCTGA No data
Right 966692483 3:182756131-182756153 GTCTGGATAGTTTTTGAGACAGG No data
966692479_966692483 18 Left 966692479 3:182756090-182756112 CCAAGTTAAAAAACCTCTCTGAG No data
Right 966692483 3:182756131-182756153 GTCTGGATAGTTTTTGAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966692483 Original CRISPR GTCTGGATAGTTTTTGAGAC AGG Intergenic