ID: 966693689

View in Genome Browser
Species Human (GRCh38)
Location 3:182767497-182767519
Sequence TCAGGAGTTCGAGACCAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966693689_966693697 17 Left 966693689 3:182767497-182767519 CCAGGCTGGTCTCGAACTCCTGA No data
Right 966693697 3:182767537-182767559 ACCTTGGCCTCCCAAAGTGTTGG No data
966693689_966693693 1 Left 966693689 3:182767497-182767519 CCAGGCTGGTCTCGAACTCCTGA No data
Right 966693693 3:182767521-182767543 CTCAGGTGATCCACCCACCTTGG No data
966693689_966693701 26 Left 966693689 3:182767497-182767519 CCAGGCTGGTCTCGAACTCCTGA No data
Right 966693701 3:182767546-182767568 TCCCAAAGTGTTGGGATTACAGG No data
966693689_966693699 18 Left 966693689 3:182767497-182767519 CCAGGCTGGTCTCGAACTCCTGA No data
Right 966693699 3:182767538-182767560 CCTTGGCCTCCCAAAGTGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966693689 Original CRISPR TCAGGAGTTCGAGACCAGCC TGG (reversed) Intergenic