ID: 966693692 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 3:182767520-182767542 |
Sequence | CAAGGTGGGTGGATCACCTG AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 4 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
966693692_966693699 | -5 | Left | 966693692 | 3:182767520-182767542 | CCTCAGGTGATCCACCCACCTTG | No data | ||
Right | 966693699 | 3:182767538-182767560 | CCTTGGCCTCCCAAAGTGTTGGG | 0: 6703 1: 100902 2: 223602 3: 235479 4: 140081 |
||||
966693692_966693701 | 3 | Left | 966693692 | 3:182767520-182767542 | CCTCAGGTGATCCACCCACCTTG | No data | ||
Right | 966693701 | 3:182767546-182767568 | TCCCAAAGTGTTGGGATTACAGG | No data | ||||
966693692_966693697 | -6 | Left | 966693692 | 3:182767520-182767542 | CCTCAGGTGATCCACCCACCTTG | No data | ||
Right | 966693697 | 3:182767537-182767559 | ACCTTGGCCTCCCAAAGTGTTGG | No data | ||||
966693692_966693704 | 22 | Left | 966693692 | 3:182767520-182767542 | CCTCAGGTGATCCACCCACCTTG | No data | ||
Right | 966693704 | 3:182767565-182767587 | CAGGCATGAGCCACCGCGCCCGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
966693692 | Original CRISPR | CAAGGTGGGTGGATCACCTG AGG (reversed) | Intergenic | ||