ID: 966693692

View in Genome Browser
Species Human (GRCh38)
Location 3:182767520-182767542
Sequence CAAGGTGGGTGGATCACCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966693692_966693701 3 Left 966693692 3:182767520-182767542 CCTCAGGTGATCCACCCACCTTG No data
Right 966693701 3:182767546-182767568 TCCCAAAGTGTTGGGATTACAGG No data
966693692_966693699 -5 Left 966693692 3:182767520-182767542 CCTCAGGTGATCCACCCACCTTG No data
Right 966693699 3:182767538-182767560 CCTTGGCCTCCCAAAGTGTTGGG No data
966693692_966693697 -6 Left 966693692 3:182767520-182767542 CCTCAGGTGATCCACCCACCTTG No data
Right 966693697 3:182767537-182767559 ACCTTGGCCTCCCAAAGTGTTGG No data
966693692_966693704 22 Left 966693692 3:182767520-182767542 CCTCAGGTGATCCACCCACCTTG No data
Right 966693704 3:182767565-182767587 CAGGCATGAGCCACCGCGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966693692 Original CRISPR CAAGGTGGGTGGATCACCTG AGG (reversed) Intergenic