ID: 966693693 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:182767521-182767543 |
| Sequence | CTCAGGTGATCCACCCACCT TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 966693688_966693693 | 10 | Left | 966693688 | 3:182767488-182767510 | CCATCTTGGCCAGGCTGGTCTCG | No data | ||
| Right | 966693693 | 3:182767521-182767543 | CTCAGGTGATCCACCCACCTTGG | No data | ||||
| 966693689_966693693 | 1 | Left | 966693689 | 3:182767497-182767519 | CCAGGCTGGTCTCGAACTCCTGA | No data | ||
| Right | 966693693 | 3:182767521-182767543 | CTCAGGTGATCCACCCACCTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 966693693 | Original CRISPR | CTCAGGTGATCCACCCACCT TGG | Intergenic | ||