ID: 966693694 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 3:182767531-182767553 |
Sequence | CTTTGGGAGGCCAAGGTGGG TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
966693694_966693701 | -8 | Left | 966693694 | 3:182767531-182767553 | CCACCCACCTTGGCCTCCCAAAG | No data | ||
Right | 966693701 | 3:182767546-182767568 | TCCCAAAGTGTTGGGATTACAGG | No data | ||||
966693694_966693707 | 24 | Left | 966693694 | 3:182767531-182767553 | CCACCCACCTTGGCCTCCCAAAG | No data | ||
Right | 966693707 | 3:182767578-182767600 | CCGCGCCCGGCCTATGAAATAGG | No data | ||||
966693694_966693704 | 11 | Left | 966693694 | 3:182767531-182767553 | CCACCCACCTTGGCCTCCCAAAG | No data | ||
Right | 966693704 | 3:182767565-182767587 | CAGGCATGAGCCACCGCGCCCGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
966693694 | Original CRISPR | CTTTGGGAGGCCAAGGTGGG TGG (reversed) | Intergenic | ||