ID: 966693694

View in Genome Browser
Species Human (GRCh38)
Location 3:182767531-182767553
Sequence CTTTGGGAGGCCAAGGTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966693694_966693704 11 Left 966693694 3:182767531-182767553 CCACCCACCTTGGCCTCCCAAAG No data
Right 966693704 3:182767565-182767587 CAGGCATGAGCCACCGCGCCCGG No data
966693694_966693701 -8 Left 966693694 3:182767531-182767553 CCACCCACCTTGGCCTCCCAAAG No data
Right 966693701 3:182767546-182767568 TCCCAAAGTGTTGGGATTACAGG No data
966693694_966693707 24 Left 966693694 3:182767531-182767553 CCACCCACCTTGGCCTCCCAAAG No data
Right 966693707 3:182767578-182767600 CCGCGCCCGGCCTATGAAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966693694 Original CRISPR CTTTGGGAGGCCAAGGTGGG TGG (reversed) Intergenic