ID: 966693694

View in Genome Browser
Species Human (GRCh38)
Location 3:182767531-182767553
Sequence CTTTGGGAGGCCAAGGTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 533845
Summary {0: 21198, 1: 71365, 2: 150513, 3: 157804, 4: 132965}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966693694_966693707 24 Left 966693694 3:182767531-182767553 CCACCCACCTTGGCCTCCCAAAG 0: 21198
1: 71365
2: 150513
3: 157804
4: 132965
Right 966693707 3:182767578-182767600 CCGCGCCCGGCCTATGAAATAGG No data
966693694_966693704 11 Left 966693694 3:182767531-182767553 CCACCCACCTTGGCCTCCCAAAG 0: 21198
1: 71365
2: 150513
3: 157804
4: 132965
Right 966693704 3:182767565-182767587 CAGGCATGAGCCACCGCGCCCGG 0: 7065
1: 55609
2: 120140
3: 162711
4: 170813
966693694_966693701 -8 Left 966693694 3:182767531-182767553 CCACCCACCTTGGCCTCCCAAAG 0: 21198
1: 71365
2: 150513
3: 157804
4: 132965
Right 966693701 3:182767546-182767568 TCCCAAAGTGTTGGGATTACAGG 0: 21407
1: 311432
2: 256151
3: 138115
4: 123943

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966693694 Original CRISPR CTTTGGGAGGCCAAGGTGGG TGG (reversed) Intergenic
Too many off-targets to display for this crispr