ID: 966693695

View in Genome Browser
Species Human (GRCh38)
Location 3:182767534-182767556
Sequence ACACTTTGGGAGGCCAAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 641247
Summary {0: 2536, 1: 40105, 2: 146028, 3: 241222, 4: 211356}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966693695_966693707 21 Left 966693695 3:182767534-182767556 CCCACCTTGGCCTCCCAAAGTGT 0: 2536
1: 40105
2: 146028
3: 241222
4: 211356
Right 966693707 3:182767578-182767600 CCGCGCCCGGCCTATGAAATAGG No data
966693695_966693704 8 Left 966693695 3:182767534-182767556 CCCACCTTGGCCTCCCAAAGTGT 0: 2536
1: 40105
2: 146028
3: 241222
4: 211356
Right 966693704 3:182767565-182767587 CAGGCATGAGCCACCGCGCCCGG 0: 7065
1: 55609
2: 120140
3: 162711
4: 170813

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966693695 Original CRISPR ACACTTTGGGAGGCCAAGGT GGG (reversed) Intergenic
Too many off-targets to display for this crispr