ID: 966693696

View in Genome Browser
Species Human (GRCh38)
Location 3:182767535-182767557
Sequence AACACTTTGGGAGGCCAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 477786
Summary {0: 4221, 1: 66343, 2: 155330, 3: 159343, 4: 92549}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966693696_966693707 20 Left 966693696 3:182767535-182767557 CCACCTTGGCCTCCCAAAGTGTT 0: 4221
1: 66343
2: 155330
3: 159343
4: 92549
Right 966693707 3:182767578-182767600 CCGCGCCCGGCCTATGAAATAGG No data
966693696_966693704 7 Left 966693696 3:182767535-182767557 CCACCTTGGCCTCCCAAAGTGTT 0: 4221
1: 66343
2: 155330
3: 159343
4: 92549
Right 966693704 3:182767565-182767587 CAGGCATGAGCCACCGCGCCCGG 0: 7065
1: 55609
2: 120140
3: 162711
4: 170813

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966693696 Original CRISPR AACACTTTGGGAGGCCAAGG TGG (reversed) Intergenic
Too many off-targets to display for this crispr