ID: 966693697

View in Genome Browser
Species Human (GRCh38)
Location 3:182767537-182767559
Sequence ACCTTGGCCTCCCAAAGTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966693688_966693697 26 Left 966693688 3:182767488-182767510 CCATCTTGGCCAGGCTGGTCTCG No data
Right 966693697 3:182767537-182767559 ACCTTGGCCTCCCAAAGTGTTGG No data
966693689_966693697 17 Left 966693689 3:182767497-182767519 CCAGGCTGGTCTCGAACTCCTGA No data
Right 966693697 3:182767537-182767559 ACCTTGGCCTCCCAAAGTGTTGG No data
966693691_966693697 -1 Left 966693691 3:182767515-182767537 CCTGACCTCAGGTGATCCACCCA No data
Right 966693697 3:182767537-182767559 ACCTTGGCCTCCCAAAGTGTTGG No data
966693692_966693697 -6 Left 966693692 3:182767520-182767542 CCTCAGGTGATCCACCCACCTTG No data
Right 966693697 3:182767537-182767559 ACCTTGGCCTCCCAAAGTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966693697 Original CRISPR ACCTTGGCCTCCCAAAGTGT TGG Intergenic