ID: 966693698

View in Genome Browser
Species Human (GRCh38)
Location 3:182767538-182767560
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966693698_966693707 17 Left 966693698 3:182767538-182767560 CCTTGGCCTCCCAAAGTGTTGGG No data
Right 966693707 3:182767578-182767600 CCGCGCCCGGCCTATGAAATAGG No data
966693698_966693704 4 Left 966693698 3:182767538-182767560 CCTTGGCCTCCCAAAGTGTTGGG No data
Right 966693704 3:182767565-182767587 CAGGCATGAGCCACCGCGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966693698 Original CRISPR CCCAACACTTTGGGAGGCCA AGG (reversed) Intergenic