ID: 966693700

View in Genome Browser
Species Human (GRCh38)
Location 3:182767544-182767566
Sequence TGTAATCCCAACACTTTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 863303
Summary {0: 20711, 1: 314656, 2: 260585, 3: 140497, 4: 126854}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966693700_966693704 -2 Left 966693700 3:182767544-182767566 CCTCCCAAAGTGTTGGGATTACA 0: 20711
1: 314656
2: 260585
3: 140497
4: 126854
Right 966693704 3:182767565-182767587 CAGGCATGAGCCACCGCGCCCGG 0: 7065
1: 55609
2: 120140
3: 162711
4: 170813
966693700_966693707 11 Left 966693700 3:182767544-182767566 CCTCCCAAAGTGTTGGGATTACA 0: 20711
1: 314656
2: 260585
3: 140497
4: 126854
Right 966693707 3:182767578-182767600 CCGCGCCCGGCCTATGAAATAGG No data
966693700_966693711 30 Left 966693700 3:182767544-182767566 CCTCCCAAAGTGTTGGGATTACA 0: 20711
1: 314656
2: 260585
3: 140497
4: 126854
Right 966693711 3:182767597-182767619 TAGGTACTCATTTTCAGTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966693700 Original CRISPR TGTAATCCCAACACTTTGGG AGG (reversed) Intergenic
Too many off-targets to display for this crispr