ID: 966693701

View in Genome Browser
Species Human (GRCh38)
Location 3:182767546-182767568
Sequence TCCCAAAGTGTTGGGATTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966693689_966693701 26 Left 966693689 3:182767497-182767519 CCAGGCTGGTCTCGAACTCCTGA No data
Right 966693701 3:182767546-182767568 TCCCAAAGTGTTGGGATTACAGG No data
966693692_966693701 3 Left 966693692 3:182767520-182767542 CCTCAGGTGATCCACCCACCTTG No data
Right 966693701 3:182767546-182767568 TCCCAAAGTGTTGGGATTACAGG No data
966693691_966693701 8 Left 966693691 3:182767515-182767537 CCTGACCTCAGGTGATCCACCCA No data
Right 966693701 3:182767546-182767568 TCCCAAAGTGTTGGGATTACAGG No data
966693694_966693701 -8 Left 966693694 3:182767531-182767553 CCACCCACCTTGGCCTCCCAAAG No data
Right 966693701 3:182767546-182767568 TCCCAAAGTGTTGGGATTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966693701 Original CRISPR TCCCAAAGTGTTGGGATTAC AGG Intergenic