ID: 966693701

View in Genome Browser
Species Human (GRCh38)
Location 3:182767546-182767568
Sequence TCCCAAAGTGTTGGGATTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 851048
Summary {0: 21407, 1: 311432, 2: 256151, 3: 138115, 4: 123943}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966693691_966693701 8 Left 966693691 3:182767515-182767537 CCTGACCTCAGGTGATCCACCCA 0: 15131
1: 42916
2: 78223
3: 96454
4: 105535
Right 966693701 3:182767546-182767568 TCCCAAAGTGTTGGGATTACAGG 0: 21407
1: 311432
2: 256151
3: 138115
4: 123943
966693694_966693701 -8 Left 966693694 3:182767531-182767553 CCACCCACCTTGGCCTCCCAAAG 0: 21198
1: 71365
2: 150513
3: 157804
4: 132965
Right 966693701 3:182767546-182767568 TCCCAAAGTGTTGGGATTACAGG 0: 21407
1: 311432
2: 256151
3: 138115
4: 123943
966693692_966693701 3 Left 966693692 3:182767520-182767542 CCTCAGGTGATCCACCCACCTTG 0: 4668
1: 19931
2: 47709
3: 74326
4: 87194
Right 966693701 3:182767546-182767568 TCCCAAAGTGTTGGGATTACAGG 0: 21407
1: 311432
2: 256151
3: 138115
4: 123943
966693689_966693701 26 Left 966693689 3:182767497-182767519 CCAGGCTGGTCTCGAACTCCTGA 0: 51840
1: 157012
2: 220107
3: 177064
4: 94849
Right 966693701 3:182767546-182767568 TCCCAAAGTGTTGGGATTACAGG 0: 21407
1: 311432
2: 256151
3: 138115
4: 123943

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966693701 Original CRISPR TCCCAAAGTGTTGGGATTAC AGG Intergenic
Too many off-targets to display for this crispr