ID: 966693702

View in Genome Browser
Species Human (GRCh38)
Location 3:182767547-182767569
Sequence GCCTGTAATCCCAACACTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966693702_966693707 8 Left 966693702 3:182767547-182767569 CCCAAAGTGTTGGGATTACAGGC No data
Right 966693707 3:182767578-182767600 CCGCGCCCGGCCTATGAAATAGG No data
966693702_966693711 27 Left 966693702 3:182767547-182767569 CCCAAAGTGTTGGGATTACAGGC No data
Right 966693711 3:182767597-182767619 TAGGTACTCATTTTCAGTTAAGG No data
966693702_966693704 -5 Left 966693702 3:182767547-182767569 CCCAAAGTGTTGGGATTACAGGC No data
Right 966693704 3:182767565-182767587 CAGGCATGAGCCACCGCGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966693702 Original CRISPR GCCTGTAATCCCAACACTTT GGG (reversed) Intergenic