ID: 966693703

View in Genome Browser
Species Human (GRCh38)
Location 3:182767548-182767570
Sequence TGCCTGTAATCCCAACACTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 803241
Summary {0: 7114, 1: 109335, 2: 242763, 3: 237820, 4: 206209}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966693703_966693711 26 Left 966693703 3:182767548-182767570 CCAAAGTGTTGGGATTACAGGCA 0: 7114
1: 109335
2: 242763
3: 237820
4: 206209
Right 966693711 3:182767597-182767619 TAGGTACTCATTTTCAGTTAAGG No data
966693703_966693704 -6 Left 966693703 3:182767548-182767570 CCAAAGTGTTGGGATTACAGGCA 0: 7114
1: 109335
2: 242763
3: 237820
4: 206209
Right 966693704 3:182767565-182767587 CAGGCATGAGCCACCGCGCCCGG 0: 7065
1: 55609
2: 120140
3: 162711
4: 170813
966693703_966693707 7 Left 966693703 3:182767548-182767570 CCAAAGTGTTGGGATTACAGGCA 0: 7114
1: 109335
2: 242763
3: 237820
4: 206209
Right 966693707 3:182767578-182767600 CCGCGCCCGGCCTATGAAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966693703 Original CRISPR TGCCTGTAATCCCAACACTT TGG (reversed) Intergenic
Too many off-targets to display for this crispr